Human TDP-43-mu/ALS10/TDP-43 ORF/cDNA clone-Lentivirus particle (NM_007375.3)
Cat. No.: vGMLV000575
Pre-made Human TDP-43-mu/ALS10/TDP-43 Lentiviral expression plasmid for TDP-43-mu lentivirus packaging, TDP-43-mu lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
TARDBP/TDP-43-mu/ALS10 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV000575 | Human TDP-43-mu Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV000575 |
Gene Name | TDP-43-mu |
Accession Number | NM_007375.3 |
Gene ID | 23435 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1245 bp |
Gene Alias | ALS10,TDP-43 |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTCTGAATATATTCGGGTAACCGAAGATGAGAACGATGAGCCCATTGAAATACCATCGGAAGACGATGGGACGGTGCTGCTCTCCACGGTTACAGCCCAGTTTCCAGGGGCGTGTGGGCTTCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTAGAAGGAATTCTGCATGCCCCAGATGCTGGCTGGGGAAATCTGGTGTATGTTGTCAACTATCCAAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTCCAGAAAACATCCGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACCGAACAGGACCTGAAAGAGTATTTTAGTACCTTTGGAGAAGTTCTTATGGTGCAGGTCAAGAAAGATCTTAAGACTGGTCATTCAAAGGGGTTTGGCTTTGTTCGTTTTACGGAATATGAAACACAAGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGCAAACTTCCTAATTCTAAGCAAAGCCAAGATGAGCCTTTGAGAAGCAGAAAAGTGTTTGTGGGGCGCTGTACAGAGGACATGACTGAGGATGAGCTGCGGGAGTTCTTCTCTCAGTACGGGGATGTGATGGATGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCCTTTGTTACATTTGCAGATGATCAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATGTAG |
ORF Protein Sequence | MSEYIRVTEDENDEPIEIPSEDDGTVLLSTVTAQFPGACGLRYRNPVSQCMRGVRLVEGILHAPDAGWGNLVYVVNYPKDNKRKMDETDASSAVKVKRAVQKTSDLIVLGLPWKTTEQDLKEYFSTFGEVLMVQVKKDLKTGHSKGFGFVRFTEYETQVKVMSQRHMIDGRWCDCKLPNSKQSQDEPLRSRKVFVGRCTEDMTEDELREFFSQYGDVMDVFIPKPFRAFAFVTFADDQIAQSLCGEDLIIKGISVHISNAEPKHNSNRQLERSGRFGGNPGGFGNQGGFGNSRGGGAGLGNNQGSNMGGGMNFGAFSINPAMMAAAQAALQSSWGMMGMLASQQNQSGPSGNNQNQGNMQREPNQAFGSGNNSYSGSNSGAAIGWGSASNAGSGSGFNGGFGSSMDSKSSGWGM |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T08014-Ab | Anti-TARDBP monoclonal antibody |
Target Antigen | GM-Tg-g-T08014-Ag | TARDBP protein |
ORF Viral Vector | pGMLP002200 | Human TARDBP Lentivirus plasmid |
ORF Viral Vector | pGMLV000575 | Human TDP-43-mu Lentivirus plasmid |
ORF Viral Vector | pGMLV000576 | Human TARDBP Lentivirus plasmid |
ORF Viral Vector | vGMLP002200 | Human TARDBP Lentivirus particle |
ORF Viral Vector | vGMLV000575 | Human TDP-43-mu Lentivirus particle |
ORF Viral Vector | vGMLV000576 | Human TARDBP Lentivirus particle |
Target information
Target ID | GM-T08014 |
Target Name | TARDBP |
Gene ID | 23435, 230908, 100423163, 298648, 101097257, 478234, 540632, 100051482 |
Gene Symbol and Synonyms | 1190002A23Rik,ALS10,TARDBP,TDP-43,Tdp43 |
Uniprot Accession | Q13148 |
Uniprot Entry Name | TADBP_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000120948 |
Target Classification | Not Available |
HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene is a transcriptional repressor that binds to chromosomally integrated TAR DNA and represses HIV-1 transcription. In addition, this protein regulates alternate splicing of the CFTR gene. A similar pseudogene is present on chromosome 20. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.