Human DDAH1/DDAH/DDAH-1 ORF/cDNA clone-Lentivirus plasmid (NM_012137)
Cat. No.: pGMLV000601
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human DDAH1/DDAH/DDAH-1 Lentiviral expression plasmid for DDAH1 lentivirus packaging, DDAH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
DDAH1/DDAH products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV000601 |
| Gene Name | DDAH1 |
| Accession Number | NM_012137 |
| Gene ID | 23576 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 858 bp |
| Gene Alias | DDAH,DDAH-1,DDAHI,HEL-S-16 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCGGGCTCGGCCACCCCGCCGCCTTCGGCCGGGCCACCCACGCCGTGGTGCGGGCGCTACCCGAGTCGCTCGGCCAGCACGCGCTGAGAAGCGCCAAGGGCGAGGAGGTGGACGTCGCCCGCGCGGAACGGCAGCACCAGCTCTACGTGGGCGTGCTGGGCAGCAAGCTGGGGCTGCAGGTGGTGGAGCTGCCGGCCGACGAGAGCCTTCCGGACTGCGTCTTCGTGGAGGACGTGGCCGTGGTGTGCGAGGAGACGGCCCTCATCACCCGACCCGGGGCGCCGAGCCGGAGGAAGGAGGTTGACATGATGAAAGAAGCATTAGAAAAACTTCAGCTCAATATAGTAGAGATGAAAGATGAAAATGCAACTTTAGATGGCGGAGATGTTTTATTCACAGGCAGAGAATTTTTTGTGGGCCTTTCCAAAAGGACAAATCAACGAGGTGCTGAAATCTTGGCTGATACTTTTAAGGACTATGCAGTCTCCACAGTGCCAGTGGCAGATGGGTTGCATTTGAAGAGTTTCTGCAGCATGGCTGGGCCTAACCTGATCGCAATTGGGTCTAGTGAATCTGCACAGAAGGCCCTTAAGATCATGCAACAGATGAGTGACCACCGCTACGACAAACTCACTGTGCCTGATGACATAGCAGCAAACTGTATATATCTAAATATCCCCAACAAAGGGCACGTCTTGCTGCACCGAACCCCGGAAGAGTATCCAGAAAGTGCAAAGGTTTATGAGAAACTGAAGGACCATATGCTGATCCCCGTGAGCATGTCTGAACTGGAAAAGGTGGATGGGCTGCTCACCTGCTGCTCAGTTTTAATTAACAAGAAAGTAGACTCCTGA |
| ORF Protein Sequence | MAGLGHPAAFGRATHAVVRALPESLGQHALRSAKGEEVDVARAERQHQLYVGVLGSKLGLQVVELPADESLPDCVFVEDVAVVCEETALITRPGAPSRRKEVDMMKEALEKLQLNIVEMKDENATLDGGDVLFTGREFFVGLSKRTNQRGAEILADTFKDYAVSTVPVADGLHLKSFCSMAGPNLIAIGSSESAQKALKIMQQMSDHRYDKLTVPDDIAANCIYLNIPNKGHVLLHRTPEEYPESAKVYEKLKDHMLIPVSMSELEKVDGLLTCCSVLINKKVDS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP2449-Ab | Anti-DDAH1 monoclonal antibody |
| Target Antigen | GM-Tg-g-IP2449-Ag | DDAH1 protein |
| ORF Viral Vector | pGMLP001020 | Human DDAH1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000601 | Human DDAH1 Lentivirus plasmid |
| ORF Viral Vector | vGMLP001020 | Human DDAH1 Lentivirus particle |
| ORF Viral Vector | vGMLV000601 | Human DDAH1 Lentivirus particle |
Target information
| Target ID | GM-IP2449 |
| Target Name | DDAH1 |
| Gene ID | 23576, 69219, 711395, 64157, 101099817, 490182, 537391, 100064154 |
| Gene Symbol and Synonyms | 2410006N07Rik,2510015N06Rik,DDAH,DDAH-1,DDAH1,DDAHI,HEL-S-16 |
| Uniprot Accession | O94760 |
| Uniprot Entry Name | DDAH1_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000153904 |
| Target Classification | Not Available |
This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


