Human DDAH1/DDAH/DDAH-1 ORF/cDNA clone-Lentivirus particle (NM_012137)

Cat. No.: vGMLP001020

Pre-made Human DDAH1/DDAH/DDAH-1 Lentiviral expression plasmid for DDAH1 lentivirus packaging, DDAH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to DDAH1/DDAH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001020 Human DDAH1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001020
Gene Name DDAH1
Accession Number NM_012137
Gene ID 23576
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 858 bp
Gene Alias DDAH,DDAH-1,DDAHI,HEL-S-16
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCGGGCTCGGCCACCCCGCCGCCTTCGGCCGGGCCACCCACGCCGTGGTGCGGGCGCTACCCGAGTCGCTCGGCCAGCACGCGCTGAGAAGCGCCAAGGGCGAGGAGGTGGACGTCGCCCGCGCGGAACGGCAGCACCAGCTCTACGTGGGCGTGCTGGGCAGCAAGCTGGGGCTGCAGGTGGTGGAGCTGCCGGCCGACGAGAGCCTTCCGGACTGCGTCTTCGTGGAGGACGTGGCCGTGGTGTGCGAGGAGACGGCCCTCATCACCCGACCCGGGGCGCCGAGCCGGAGGAAGGAGGTTGACATGATGAAAGAAGCATTAGAAAAACTTCAGCTCAATATAGTAGAGATGAAAGATGAAAATGCAACTTTAGATGGCGGAGATGTTTTATTCACAGGCAGAGAATTTTTTGTGGGCCTTTCCAAAAGGACAAATCAACGAGGTGCTGAAATCTTGGCTGATACTTTTAAGGACTATGCAGTCTCCACAGTGCCAGTGGCAGATGGGTTGCATTTGAAGAGTTTCTGCAGCATGGCTGGGCCTAACCTGATCGCAATTGGGTCTAGTGAATCTGCACAGAAGGCCCTTAAGATCATGCAACAGATGAGTGACCACCGCTACGACAAACTCACTGTGCCTGATGACATAGCAGCAAACTGTATATATCTAAATATCCCCAACAAAGGGCACGTCTTGCTGCACCGAACCCCGGAAGAGTATCCAGAAAGTGCAAAGGTTTATGAGAAACTGAAGGACCATATGCTGATCCCCGTGAGCATGTCTGAACTGGAAAAGGTGGATGGGCTGCTCACCTGCTGCTCAGTTTTAATTAACAAGAAAGTAGACTCCTGA
ORF Protein Sequence MAGLGHPAAFGRATHAVVRALPESLGQHALRSAKGEEVDVARAERQHQLYVGVLGSKLGLQVVELPADESLPDCVFVEDVAVVCEETALITRPGAPSRRKEVDMMKEALEKLQLNIVEMKDENATLDGGDVLFTGREFFVGLSKRTNQRGAEILADTFKDYAVSTVPVADGLHLKSFCSMAGPNLIAIGSSESAQKALKIMQQMSDHRYDKLTVPDDIAANCIYLNIPNKGHVLLHRTPEEYPESAKVYEKLKDHMLIPVSMSELEKVDGLLTCCSVLINKKVDS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2449-Ab Anti-DDAH1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2449-Ag DDAH1 protein
    ORF Viral Vector pGMLP001020 Human DDAH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000601 Human DDAH1 Lentivirus plasmid
    ORF Viral Vector vGMLP001020 Human DDAH1 Lentivirus particle
    ORF Viral Vector vGMLV000601 Human DDAH1 Lentivirus particle


    Target information

    Target ID GM-IP2449
    Target Name DDAH1
    Gene ID 23576, 69219, 711395, 64157, 101099817, 490182, 537391, 100064154
    Gene Symbol and Synonyms 2410006N07Rik,2510015N06Rik,DDAH,DDAH-1,DDAH1,DDAHI,HEL-S-16
    Uniprot Accession O94760
    Uniprot Entry Name DDAH1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000153904
    Target Classification Not Available

    This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.