Human KCNJ5/CIR/GIRK4 ORF/cDNA clone-Lentivirus plasmid (NM_000890)

Cat. No.: pGMLV000824
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNJ5/CIR/GIRK4 Lentiviral expression plasmid for KCNJ5 lentivirus packaging, KCNJ5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to KCNJ5/CIR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $652.8
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000824
Gene Name KCNJ5
Accession Number NM_000890
Gene ID 3762
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1260 bp
Gene Alias CIR,GIRK4,KATP1,KIR3.4,LQT13
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGGCGATTCTAGGAATGCCATGAACCAGGACATGGAGATTGGAGTCACTCCCTGGGACCCCAAGAAGATTCCAAAACAGGCCCGCGATTATGTCCCCATTGCCACAGACCGTACGCGCCTGCTGGCCGAGGGCAAGAAGCCACGCCAGCGCTACATGGAGAAGAGTGGCAAGTGCAACGTGCACCACGGCAACGTCCAGGAGACCTACCGGTACCTGAGTGACCTCTTCACCACCCTGGTGGACCTCAAGTGGCGCTTCAACTTGCTCGTCTTCACCATGGTTTACACTGTCACCTGGCTGTTCTTCGGCTTCATTTGGTGGCTCATTGCTTATATCCGGGGTGACCTGGACCATGTTGGCGACCAAGAGTGGATTCCTTGTGTTGAAAACCTCAGTGGCTTCGTGTCCGCTTTCCTGTTCTCCATTGAGACCGAAACAACCATTGGGTATGGCTTCCGAGTCATCACAGAGAAGTGTCCAGAGGGGATTATACTCCTCTTGGTCCAGGCCATCCTGGGCTCCATCGTCAATGCCTTCATGGTGGGGTGCATGTTTGTCAAGATCAGCCAGCCCAAGAAGAGAGCGGAGACCCTCATGTTTTCCAACAACGCAGTCATCTCCATGCGGGACGAGAAGCTGTGCCTCATGTTCCGGGTGGGCGACCTCCGCAACTCCCACATCGTGGAGGCCTCCATCCGGGCCAAGCTCATCAAGTCCCGGCAGACCAAAGAGGGGGAGTTCATCCCCCTGAACCAGACAGACATCAACGTGGGCTTTGACACGGGCGACGACCGCCTCTTCCTTGTGTCTCCTCTGATCATCTCCCATGAGATCAACCAGAAGAGCCCTTTCTGGGAGATGTCTCAGGCTCAGCTGCATCAGGAAGAGTTTGAAGTTGTGGTCATTCTAGAAGGGATGGTGGAAGCCACAGGCATGACCTGCCAAGCCCGGAGCTCCTACATGGATACAGAGGTGCTCTGGGGCCACCGATTCACACCAGTCCTCACCTTGGAAAAGGGCTTCTATGAGGTGGACTACAACACCTTCCATGATACCTATGAGACCAACACACCCAGCTGCTGTGCCAAGGAGCTGGCAGAAATGAAGAGGGAAGGCCGGCTCCTCCAGTACCTCCCCAGCCCCCCACTGCTGGGGGGCTGTGCTGAGGCAGGGCTGGATGCAGAGGCTGAGCAGAATGAAGAAGATGAGCCCAAGGGGCTGGGTGGGTCCAGGGAGGCCAGGGGCTCGGTGTGA
ORF Protein Sequence MAGDSRNAMNQDMEIGVTPWDPKKIPKQARDYVPIATDRTRLLAEGKKPRQRYMEKSGKCNVHHGNVQETYRYLSDLFTTLVDLKWRFNLLVFTMVYTVTWLFFGFIWWLIAYIRGDLDHVGDQEWIPCVENLSGFVSAFLFSIETETTIGYGFRVITEKCPEGIILLLVQAILGSIVNAFMVGCMFVKISQPKKRAETLMFSNNAVISMRDEKLCLMFRVGDLRNSHIVEASIRAKLIKSRQTKEGEFIPLNQTDINVGFDTGDDRLFLVSPLIISHEINQKSPFWEMSQAQLHQEEFEVVVILEGMVEATGMTCQARSSYMDTEVLWGHRFTPVLTLEKGFYEVDYNTFHDTYETNTPSCCAKELAEMKREGRLLQYLPSPPLLGGCAEAGLDAEAEQNEEDEPKGLGGSREARGSV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78692-Ab Anti-KCNJ5/ CIR/ GIRK4 monoclonal antibody
    Target Antigen GM-Tg-g-T78692-Ag KCNJ5 VLP (virus-like particle)
    ORF Viral Vector pGMLP003673 Human KCNJ5 Lentivirus plasmid
    ORF Viral Vector pGMLV000824 Human KCNJ5 Lentivirus plasmid
    ORF Viral Vector vGMLP003673 Human KCNJ5 Lentivirus particle
    ORF Viral Vector vGMLV000824 Human KCNJ5 Lentivirus particle


    Target information

    Target ID GM-T78692
    Target Name KCNJ5
    Gene ID 3762, 16521, 714799, 29713, 101091726, 489284, 539844, 100064621
    Gene Symbol and Synonyms CIR,GIRK-4,GIRK4,KATP-1,KATP1,KCNJ5,KIR3.4,LQT13
    Uniprot Accession P48544
    Uniprot Entry Name KCNJ5_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000120457
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes an integral membrane protein which belongs to one of seven subfamilies of inward-rectifier potassium channel proteins called potassium channel subfamily J. The encoded protein is a subunit of the potassium channel which is homotetrameric. It is controlled by G-proteins and has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Naturally occurring mutations in this gene are associated with aldosterone-producing adenomas. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.