Human RAC1/MIG5/ MRD48 ORF/cDNA clone-Lentivirus plasmid (NM_006908.4)

Pre-made Human RAC1/MIG5/ MRD48 Lentiviral expression plasmid for RAC1 lentivirus packaging, RAC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to RAC1/MIG5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000896 Human RAC1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000896
Gene Name RAC1
Accession Number NM_006908.4
Gene ID 5879
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 579 bp
Gene Alias MIG5, MRD48, p21-Rac1, Rac-1, TC-25
Fluorescent Reporter
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAGCTGTAGGTAAAACTTGCCTACTGATCAGTTACACAACCAATGCATTTCCTGGAGAATATATCCCTACTGTCTTTGACAATTATTCTGCCAATGTTATGGTAGATGGAAAACCGGTGAATCTGGGCTTATGGGATACAGCTGGACAAGAAGATTATGACAGATTACGCCCCCTATCCTATCCGCAAACAGATGTGTTCTTAATTTGCTTTTCCCTTGTGAGTCCTGCATCATTTGAAAATGTCCGTGCAAAGTGGTATCCTGAGGTGCGGCACCACTGTCCCAACACTCCCATCATCCTAGTGGGAACTAAACTTGATCTTAGGGATGATAAAGACACGATCGAGAAACTGAAGGAGAAGAAGCTGACTCCCATCACCTATCCGCAGGGTCTAGCCATGGCTAAGGAGATTGGTGCTGTAAAATACCTGGAGTGCTCGGCGCTCACACAGCGAGGCCTCAAGACAGTGTTTGACGAAGCGATCCGAGCAGTCCTCTGCCCGCCTCCCGTGAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T88752-Ab Anti-RAC1 monoclonal antibody
    Target Antigen GM-Tg-g-T88752-Ag RAC1 protein
    ORF Viral Vector pGMLV000095 Human RAC1 Lentivirus plasmid
    ORF Viral Vector pGMLV000177 Human RAC1 Lentivirus plasmid
    ORF Viral Vector pGMLV000178 Human RAC1 Lentivirus plasmid
    ORF Viral Vector pGMLV000896 Human RAC1 Lentivirus plasmid
    ORF Viral Vector pGMLV001452 Human RAC1 Lentivirus plasmid
    ORF Viral Vector pGMLV001569 Human RAC1 Lentivirus plasmid
    ORF Viral Vector pGMLV002007 Human RAC1 Lentivirus plasmid
    ORF Viral Vector pGMPC000091 Human RAC1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000306 Rat Rac1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000573 Human RAC1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000586 Human RAC1 Adenovirus plasmid
    ORF Viral Vector vGMLV000095 Human RAC1 Lentivirus particle
    ORF Viral Vector vGMLV000177 Human RAC1 Lentivirus particle
    ORF Viral Vector vGMLV000178 Human RAC1 Lentivirus particle
    ORF Viral Vector vGMLV000896 Human RAC1 Lentivirus particle
    ORF Viral Vector vGMLV001452 Human RAC1 Lentivirus particle
    ORF Viral Vector vGMLV001569 Human RAC1 Lentivirus particle
    ORF Viral Vector vGMLV002007 Human RAC1 Lentivirus particle
    ORF Viral Vector vGMAP000586 Human RAC1 Adenovirus particle


    Target information

    Target ID GM-T88752
    Target Name RAC1
    Gene ID 5879, 19353, 717755, 363875, 101101277, 403955, 281440, 100061732
    Gene Symbol and Synonyms D5Ertd559e,MIG5,MRD48,p21-Rac1,Rac-1,RAC1,RAC2,TC-25
    Uniprot Accession P63000
    Uniprot Entry Name RAC1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000136238
    Target Classification Not Available

    The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.