Human RAC1/MIG5/ MRD48 ORF/cDNA clone-Lentivirus plasmid (NM_006908.4)
Pre-made Human RAC1/MIG5/ MRD48 Lentiviral expression plasmid for RAC1 lentivirus packaging, RAC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RAC1/MIG5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV000896 | Human RAC1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV000896 |
Gene Name | RAC1 |
Accession Number | NM_006908.4 |
Gene ID | 5879 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 579 bp |
Gene Alias | MIG5, MRD48, p21-Rac1, Rac-1, TC-25 |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAGCTGTAGGTAAAACTTGCCTACTGATCAGTTACACAACCAATGCATTTCCTGGAGAATATATCCCTACTGTCTTTGACAATTATTCTGCCAATGTTATGGTAGATGGAAAACCGGTGAATCTGGGCTTATGGGATACAGCTGGACAAGAAGATTATGACAGATTACGCCCCCTATCCTATCCGCAAACAGATGTGTTCTTAATTTGCTTTTCCCTTGTGAGTCCTGCATCATTTGAAAATGTCCGTGCAAAGTGGTATCCTGAGGTGCGGCACCACTGTCCCAACACTCCCATCATCCTAGTGGGAACTAAACTTGATCTTAGGGATGATAAAGACACGATCGAGAAACTGAAGGAGAAGAAGCTGACTCCCATCACCTATCCGCAGGGTCTAGCCATGGCTAAGGAGATTGGTGCTGTAAAATACCTGGAGTGCTCGGCGCTCACACAGCGAGGCCTCAAGACAGTGTTTGACGAAGCGATCCGAGCAGTCCTCTGCCCGCCTCCCGTGAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T88752-Ab | Anti-RAC1 monoclonal antibody |
Target Antigen | GM-Tg-g-T88752-Ag | RAC1 protein |
ORF Viral Vector | pGMLV000095 | Human RAC1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000177 | Human RAC1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000178 | Human RAC1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000896 | Human RAC1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001452 | Human RAC1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001569 | Human RAC1 Lentivirus plasmid |
ORF Viral Vector | pGMLV002007 | Human RAC1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000091 | Human RAC1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000306 | Rat Rac1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000573 | Human RAC1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000586 | Human RAC1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000095 | Human RAC1 Lentivirus particle |
ORF Viral Vector | vGMLV000177 | Human RAC1 Lentivirus particle |
ORF Viral Vector | vGMLV000178 | Human RAC1 Lentivirus particle |
ORF Viral Vector | vGMLV000896 | Human RAC1 Lentivirus particle |
ORF Viral Vector | vGMLV001452 | Human RAC1 Lentivirus particle |
ORF Viral Vector | vGMLV001569 | Human RAC1 Lentivirus particle |
ORF Viral Vector | vGMLV002007 | Human RAC1 Lentivirus particle |
ORF Viral Vector | vGMAP000586 | Human RAC1 Adenovirus particle |
Target information
Target ID | GM-T88752 |
Target Name | RAC1 |
Gene ID | 5879, 19353, 717755, 363875, 101101277, 403955, 281440, 100061732 |
Gene Symbol and Synonyms | D5Ertd559e,MIG5,MRD48,p21-Rac1,Rac-1,RAC1,RAC2,TC-25 |
Uniprot Accession | P63000 |
Uniprot Entry Name | RAC1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000136238 |
Target Classification | Not Available |
The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.