• Catalog ID
    vGMAP000586
  • Gene Name
    RAC1
  • Accession Number
  • Gene ID
  • Species
    Human
  • Product Type
    Adenovirus particle (overexpression)
  • Insert Length
    636 bp
  • Gene Alias
    RAC1-CFP
  • Fluorescent Label
    GFP
  • Fusion Tag
    3xflag
  • Promoter
    CMV
  • Resistance
    Amplicin
  • Sequence
    ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAGCTGTAGGTAAAACTTGCCTACTGATCAGTTACACAACCAATGCATTTCCTGGAGAATATATCCCTACTGTCTTTGACAATTATTCTGCCAATGTTATGGTAGATGGAAAACCGGTGAATCTGGGCTTATGGGATACAGCTGGACAAGAAGATTATGACAGATTACGCCCCCTATCCTATCCGCAAACAGTTGGAGAAACGTACGGTAAGGATATAACCTCCCGGGGCAAAGACAAGCCGATTGCCGATGTGTTCTTAATTTGCTTTTCCCTTGTGAGTCCTGCATCATTTGAAAATGTCCGTGCAAAGTGGTATCCTGAGGTGCGGCACCACTGTCCCAACACTCCCATCATCCTAGTGGGAACTAAACTTGATCTTAGGGATGATAAAGACACGATCGAGAAACTGAAGGAGAAGAAGCTGACTCCCATCACCTATCCGCAGGGTCTAGCCATGGCTAAGGAGATTGGTGCTGTAAAATACCTGGAGTGCTCGGCGCTCACACAGCGAGGCCTCAAGACAGTGTTTGACGAAGCGATCCGAGCAGTCCTCTGCCCGCCTCCCGTGAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAA

Background Information

Related Products

References