Human GJA1/AVSD3/CMDR ORF/cDNA clone-Lentivirus plasmid (NM_000165.5)
Cat. No.: pGMLV001053
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GJA1/AVSD3/CMDR Lentiviral expression plasmid for GJA1 lentivirus packaging, GJA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
GJA1/AVSD3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV001053 |
| Gene Name | GJA1 |
| Accession Number | NM_000165.5 |
| Gene ID | 2697 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1149 bp |
| Gene Alias | AVSD3,CMDR,CX43,EKVP,EKVP3,GJAL,HLHS1,HSS,ODDD,PPKCA |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGGGACAGCGGTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGTTGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTCATGTGCGCTTCTGGGTCCTGCAGATCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCATGTGTTCTATGTGATGCGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACTGATGGTGTCAATGTGGACATGCACTTGAAGCAGATTGAGATAAAGAAGTTCAAGTACGGTATTGAAGAGCATGGTAAGGTGAAAATGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTCTTCAAGTCTATCTTTGAGGTGGCCTTCTTGCTGATCCAGTGGTACATCTATGGATTCAGCTTGAGTGCTGTTTACACTTGCAAAAGAGATCCCTGCCCACATCAGGTGGACTGTTTCCTCTCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCCCTGGCCTTGAATATCATTGAACTCTTCTATGTTTTCTTCAAGGGCGTTAAGGATCGGGTTAAGGGAAAGAGCGACCCTTACCATGCGACCAGTGGTGCGCTGAGCCCTGCCAAAGACTGTGGGTCTCAAAAATATGCTTATTTCAATGGCTGCTCCTCACCAACCGCTCCCCTCTCGCCTATGTCTCCTCCTGGGTACAAGCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAATTACAACAAGCAAGCAAGTGAGCAAAACTGGGCTAATTACAGTGCAGAACAAAATCGAATGGGGCAGGCGGGAAGCACCATCTCTAACTCCCATGCACAGCCTTTTGATTTCCCCGATGATAACCAGAATTCTAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGCCATTGTGGACCAGCGACCTTCAAGCAGAGCCAGCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTGGAGATCTAG |
| ORF Protein Sequence | MGDWSALGKLLDKVQAYSTAGGKVWLSVLFIFRILLLGTAVESAWGDEQSAFRCNTQQPGCENVCYDKSFPISHVRFWVLQIIFVSVPTLLYLAHVFYVMRKEEKLNKKEEELKVAQTDGVNVDMHLKQIEIKKFKYGIEEHGKVKMRGGLLRTYIISILFKSIFEVAFLLIQWYIYGFSLSAVYTCKRDPCPHQVDCFLSRPTEKTIFIIFMLVVSLVSLALNIIELFYVFFKGVKDRVKGKSDPYHATSGALSPAKDCGSQKYAYFNGCSSPTAPLSPMSPPGYKLVTGDRNNSSCRNYNKQASEQNWANYSAEQNRMGQAGSTISNSHAQPFDFPDDNQNSKKLAAGHELQPLAIVDQRPSSRASSRASSRPRPDDLEI |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T44479-Ab | Anti-CXA1/ GJA1/ AVSD3 monoclonal antibody |
| Target Antigen | GM-Tg-g-T44479-Ag | GJA1 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP001348 | Human GJA1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000455 | Human GJA1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001053 | Human GJA1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001055 | Human GJA1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV002512 | Human GJA1 Lentivirus plasmid |
| ORF Viral Vector | pGMAD001175 | Human GJA1 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000184 | Human GJA1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP001348 | Human GJA1 Lentivirus particle |
| ORF Viral Vector | vGMLV000455 | Human GJA1 Lentivirus particle |
| ORF Viral Vector | vGMLV001053 | Human GJA1 Lentivirus particle |
| ORF Viral Vector | vGMLV001055 | Human GJA1 Lentivirus particle |
| ORF Viral Vector | vGMLV002512 | Human GJA1 Lentivirus particle |
| ORF Viral Vector | vGMAD001175 | Human GJA1 Adenovirus particle |
| ORF Viral Vector | vGMAP000184 | Human GJA1 Adenovirus particle |
Target information
| Target ID | GM-T44479 |
| Target Name | GJA1 |
| Gene ID | 2697, 14609, 714344, 24392, 101100211, 403418, 281193, 100067229 |
| Gene Symbol and Synonyms | AVSD3,CMDR,Cnx43,connexin43,CX43,Cx43alpha1,Cxnk1,EKVP,EKVP3,Gja-1,GJA1,GJAL,HLHS1,HSS,Npm1,ODDD,PPKCA |
| Uniprot Accession | P17302 |
| Uniprot Entry Name | CXA1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000152661 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia, autosomal recessive craniometaphyseal dysplasia and heart malformations. [provided by RefSeq, May 2014]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


