Human PTEN/10q23del/ BZS ORF/cDNA clone-Lentivirus plasmid (NM_000314)

Pre-made Human PTEN/10q23del/ BZS Lentiviral expression plasmid for PTEN lentivirus packaging, PTEN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PTEN/10q23del products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001225 Human PTEN Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001225
Gene Name PTEN
Accession Number NM_000314
Gene ID 5728
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1212 bp
Gene Alias 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1
Fluorescent Reporter
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTTTGTGCTGAAAGACATTATGACACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATACCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATCGATAGCATTTGCAGTATAGAGCGTGCAGATAATGACAAGGAATATCTAGTACTTACTTTAACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAATTTTAAGGTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGCAGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCTGACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATTACAAAAGTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T38257-Ab Anti-PTEN/ 10q23del/ BZS monoclonal antibody
    Target Antigen GM-Tg-g-T38257-Ag PTEN VLP (virus-like particle)
    ORF Viral Vector pGMLV000452 Human PTEN Lentivirus plasmid
    ORF Viral Vector pGMLV001225 Human PTEN Lentivirus plasmid
    ORF Viral Vector pGMAD000006 Human PTEN Adenovirus plasmid
    ORF Viral Vector pGMAD000353 Rat Pten Adenovirus plasmid
    ORF Viral Vector pGMAAV000222 Rat Pten Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000737 Rat Pten Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000358 Human PTEN Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP-SPh-003 Human PTEN Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-143 Human PTEN Adenovirus plasmid
    ORF Viral Vector vGMLV000452 Human PTEN Lentivirus particle
    ORF Viral Vector vGMLV001225 Human PTEN Lentivirus particle
    ORF Viral Vector vGMAD000006 Human PTEN Adenovirus particle
    ORF Viral Vector vGMAD000353 Rat Pten Adenovirus particle
    ORF Viral Vector vGMAAV000222 Rat Pten Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000737 Rat Pten Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP-SPh-003 Human PTEN Lentivirus particle
    ORF Viral Vector vGMAP-SPh-143 Human PTEN Adenovirus particle
    ORF Viral Vector pGMLV002290 Human PTEN Lentivirus plasmid


    Target information

    Target ID GM-T38257
    Target Name PTEN
    Gene ID 5728, 19211, 705121, 50557, 101091813, 403832, 540786, 100062388
    Gene Symbol and Synonyms 10q23del,2310035O07Rik,A130070J02Rik,B430203M17Rik,BZS,CWS1,DEC,GLM2,MHAM,Mmac,MMAC1,PTEN,PTEN1,PTENbeta,TEP1
    Uniprot Accession P60484
    Uniprot Entry Name PTEN_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000171862
    Target Classification Tumor-associated antigen (TAA)

    This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.