Human RCN2/E6BP/ERC-55 ORF/cDNA clone-Lentivirus plasmid (NM_002902.3)
Cat. No.: pGMLV001306
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human RCN2/E6BP/ERC-55 Lentiviral expression plasmid for RCN2 lentivirus packaging, RCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
RCN2/E6BP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV001306 |
| Gene Name | RCN2 |
| Accession Number | NM_002902.3 |
| Gene ID | 5955 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 954 bp |
| Gene Alias | E6BP,ERC-55,ERC55,TCBP49 |
| Fluorescent Reporter | Null |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | Null |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCGGCTGGGCCCGAGGACCGCGGCGTTGGGGCTGCTGCTGCTGTGCGCCGCCGCGGCCGGCGCCGGCAAGGCCGAGGAGCTGCACTACCCGCTGGGCGAGCGCCGCAGCGACTACGACCGCGAGGCGCTGCTGGGCGTCCAGGAAGATGTGGATGAATATGTTAAACTCGGCCACGAAGAGCAGCAAAAAAGACTGCAGGCGATCATAAAGAAAATCGACTTGGACTCAGATGGCTTTCTCACTGAAAGTGAACTCAGTTCATGGATTCAGATGTCTTTTAAGCATTATGCTATGCAAGAAGCAAAACAACAGTTTGTTGAATATGATAAAAACAGTGATGATACTGTGACTTGGGATGAATATAACATTCAGATGTATGATCGTGTGATTGACTTTGATGAGAACACTGCTCTGGATGATGCAGAAGAGGAGTCCTTTAGGAAGCTTCACTTAAAGGACAAGAAGCGATTTGAAAAAGCTAACCAGGATTCAGGTCCCGGTTTGAGTCTTGAAGAATTTATTGCTTTTGAGCATCCTGAAGAAGTTGATTATATGACGGAATTTGTCATTCAAGAAGCTTTAGAAGAACATGACAAAAATGGTGATGGATTTGTTAGTTTGGAAGAATTTCTTGGTGATTACAGGTGGGATCCAACTGCAAATGAAGATCCAGAATGGATACTTGTTGAGAAAGACAGATTCGTGAATGATTATGACAAAGATAACGATGGCAGGCTTGATCCCCAAGAGCTGTTACCTTGGGTAGTACCTAATAATCAGGGCATTGCACAAGAGGAGGCGCTTCATCTAATTGATGAAATGGATTTGAATGGTGACAAAAAGCTCTCTGAAGAAGAGATTCTGGAAAACCCGGACTTGTTTCTCACCAGTGAAGCCACAGATTATGGCAGACAGCTCCATGATGACTATTTCTATCATGATGAGCTTTAA |
| ORF Protein Sequence | MRLGPRTAALGLLLLCAAAAGAGKAEELHYPLGERRSDYDREALLGVQEDVDEYVKLGHEEQQKRLQAIIKKIDLDSDGFLTESELSSWIQMSFKHYAMQEAKQQFVEYDKNSDDTVTWDEYNIQMYDRVIDFDENTALDDAEEESFRKLHLKDKKRFEKANQDSGPGLSLEEFIAFEHPEEVDYMTEFVIQEALEEHDKNGDGFVSLEEFLGDYRWDPTANEDPEWILVEKDRFVNDYDKDNDGRLDPQELLPWVVPNNQGIAQEEALHLIDEMDLNGDKKLSEEEILENPDLFLTSEATDYGRQLHDDYFYHDEL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1473-Ab | Anti-RCN2/ E6BP/ ERC-55 functional antibody |
| Target Antigen | GM-Tg-g-SE1473-Ag | RCN2 protein |
| ORF Viral Vector | pGMLV001306 | Human RCN2 Lentivirus plasmid |
| ORF Viral Vector | vGMLV001306 | Human RCN2 Lentivirus particle |
Target information
| Target ID | GM-SE1473 |
| Target Name | RCN2 |
| Gene ID | 5955, 26611, 708127, 29218, 101099968, 487666, 512717, 100061087 |
| Gene Symbol and Synonyms | E6BP,ERC-55,ERC55,RCN2,TCBP49 |
| Uniprot Accession | Q14257 |
| Uniprot Entry Name | RCN2_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000117906 |
| Target Classification | Not Available |
The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


