Human RCN2/E6BP/ERC-55 ORF/cDNA clone-Lentivirus particle (NM_002902.3)

Cat. No.: vGMLV001306

Pre-made Human RCN2/E6BP/ERC-55 Lentiviral expression plasmid for RCN2 lentivirus packaging, RCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RCN2/E6BP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001306 Human RCN2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001306
Gene Name RCN2
Accession Number NM_002902.3
Gene ID 5955
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 954 bp
Gene Alias E6BP,ERC-55,ERC55,TCBP49
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGCTGGGCCCGAGGACCGCGGCGTTGGGGCTGCTGCTGCTGTGCGCCGCCGCGGCCGGCGCCGGCAAGGCCGAGGAGCTGCACTACCCGCTGGGCGAGCGCCGCAGCGACTACGACCGCGAGGCGCTGCTGGGCGTCCAGGAAGATGTGGATGAATATGTTAAACTCGGCCACGAAGAGCAGCAAAAAAGACTGCAGGCGATCATAAAGAAAATCGACTTGGACTCAGATGGCTTTCTCACTGAAAGTGAACTCAGTTCATGGATTCAGATGTCTTTTAAGCATTATGCTATGCAAGAAGCAAAACAACAGTTTGTTGAATATGATAAAAACAGTGATGATACTGTGACTTGGGATGAATATAACATTCAGATGTATGATCGTGTGATTGACTTTGATGAGAACACTGCTCTGGATGATGCAGAAGAGGAGTCCTTTAGGAAGCTTCACTTAAAGGACAAGAAGCGATTTGAAAAAGCTAACCAGGATTCAGGTCCCGGTTTGAGTCTTGAAGAATTTATTGCTTTTGAGCATCCTGAAGAAGTTGATTATATGACGGAATTTGTCATTCAAGAAGCTTTAGAAGAACATGACAAAAATGGTGATGGATTTGTTAGTTTGGAAGAATTTCTTGGTGATTACAGGTGGGATCCAACTGCAAATGAAGATCCAGAATGGATACTTGTTGAGAAAGACAGATTCGTGAATGATTATGACAAAGATAACGATGGCAGGCTTGATCCCCAAGAGCTGTTACCTTGGGTAGTACCTAATAATCAGGGCATTGCACAAGAGGAGGCGCTTCATCTAATTGATGAAATGGATTTGAATGGTGACAAAAAGCTCTCTGAAGAAGAGATTCTGGAAAACCCGGACTTGTTTCTCACCAGTGAAGCCACAGATTATGGCAGACAGCTCCATGATGACTATTTCTATCATGATGAGCTTTAA
ORF Protein Sequence MRLGPRTAALGLLLLCAAAAGAGKAEELHYPLGERRSDYDREALLGVQEDVDEYVKLGHEEQQKRLQAIIKKIDLDSDGFLTESELSSWIQMSFKHYAMQEAKQQFVEYDKNSDDTVTWDEYNIQMYDRVIDFDENTALDDAEEESFRKLHLKDKKRFEKANQDSGPGLSLEEFIAFEHPEEVDYMTEFVIQEALEEHDKNGDGFVSLEEFLGDYRWDPTANEDPEWILVEKDRFVNDYDKDNDGRLDPQELLPWVVPNNQGIAQEEALHLIDEMDLNGDKKLSEEEILENPDLFLTSEATDYGRQLHDDYFYHDEL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1473-Ab Anti-RCN2/ E6BP/ ERC-55 functional antibody
    Target Antigen GM-Tg-g-SE1473-Ag RCN2 protein
    ORF Viral Vector pGMLV001306 Human RCN2 Lentivirus plasmid
    ORF Viral Vector vGMLV001306 Human RCN2 Lentivirus particle


    Target information

    Target ID GM-SE1473
    Target Name RCN2
    Gene ID 5955, 26611, 708127, 29218, 101099968, 487666, 512717, 100061087
    Gene Symbol and Synonyms E6BP,ERC-55,ERC55,RCN2,TCBP49
    Uniprot Accession Q14257
    Uniprot Entry Name RCN2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000117906
    Target Classification Not Available

    The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.