Human ESRRA/ERR1/ ERRa ORF/cDNA clone-Lentivirus plasmid (NM_004451.5)

Pre-made Human ESRRA/ERR1/ ERRa Lentiviral expression plasmid for ESRRA lentivirus packaging, ESRRA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ESRRA/ERR1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001369 Human ESRRA Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001369
Gene Name ESRRA
Accession Number NM_004451.5
Gene ID 2101
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1272 bp
Gene Alias ERR1, ERRa, ERRalpha, ESRL1, NR3B1
Fluorescent Reporter Luciferase
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCAGCCAGGTGGTGGGCATTGAGCCTCTCTACATCAAGGCAGAGCCGGCCAGCCCTGACAGTCCAAAGGGTTCCTCGGAGACAGAGACCGAGCCTCCTGTGGCCCTGGCCCCTGGTCCAGCTCCCACTCGCTGCCTCCCAGGCCACAAGGAAGAGGAGGATGGGGAGGGGGCTGGGCCTGGCGAGCAGGGCGGTGGGAAGCTGGTGCTCAGCTCCCTGCCCAAGCGCCTCTGCCTGGTCTGTGGGGACGTGGCCTCCGGCTACCACTATGGTGTGGCATCCTGTGAGGCCTGCAAAGCCTTCTTCAAGAGGACCATCCAGGGGAGCATCGAGTACAGCTGTCCGGCCTCCAACGAGTGTGAGATCACCAAGCGGAGACGCAAGGCCTGCCAGGCCTGCCGCTTCACCAAGTGCCTGCGGGTGGGCATGCTCAAGGAGGGAGTGCGCCTGGACCGCGTCCGGGGTGGGCGGCAGAAGTACAAGCGGCGGCCGGAGGTGGACCCACTGCCCTTCCCGGGCCCCTTCCCTGCTGGGCCCCTGGCAGTCGCTGGAGGCCCCCGGAAGACAGCAGCCCCAGTGAATGCACTGGTGTCTCATCTGCTGGTGGTTGAGCCTGAGAAGCTCTATGCCATGCCTGACCCCGCAGGCCCTGATGGGCACCTCCCAGCCGTGGCTACCCTCTGTGACCTCTTTGACCGAGAGATTGTGGTCACCATCAGCTGGGCCAAGAGCATCCCAGGCTTCTCATCGCTGTCGCTGTCTGACCAGATGTCAGTACTGCAGAGCGTGTGGATGGAGGTGCTGGTGCTGGGTGTGGCCCAGCGCTCACTGCCACTGCAGGATGAGCTGGCCTTCGCTGAGGACTTAGTCCTGGATGAAGAGGGGGCACGGGCAGCTGGCCTGGGGGAACTGGGGGCTGCCCTGCTGCAACTAGTGCGGCGGCTGCAGGCCCTGCGGCTGGAGCGAGAGGAGTATGTTCTACTAAAGGCCTTGGCCCTTGCCAATTCAGACTCTGTGCACATCGAAGATGCCGAGGCTGTGGAGCAGCTGCGAGAAGCTCTGCACGAGGCCCTGCTGGAGTATGAAGCCGGCCGGGCTGGCCCCGGAGGGGGTGCTGAGCGGCGGCGGGCGGGCAGGCTGCTGCTCACGCTACCGCTCCTCCGCCAGACAGCGGGCAAAGTGCTGGCCCATTTCTATGGGGTGAAGCTGGAGGGCAAGGTGCCCATGCACAAGCTGTTCTTGGAGATGCTCGAGGCCATGATGGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T72841-Ab Anti-ESRRA monoclonal antibody
    Target Antigen GM-Tg-g-T72841-Ag ESRRA protein
    ORF Viral Vector pGMLV001369 Human ESRRA Lentivirus plasmid
    ORF Viral Vector pGMAD000107 Human ESRRA Adenovirus plasmid
    ORF Viral Vector vGMLV001369 Human ESRRA Lentivirus particle
    ORF Viral Vector vGMAD000107 Human ESRRA Adenovirus particle


    Target information

    Target ID GM-T72841
    Target Name ESRRA
    Gene ID 2101, 26379, 722085, 293701, 101099657, 403169, 507834, 100055615
    Gene Symbol and Synonyms ERR1,ERRa,ERRalpha,Errra,ESRL1,ESRRA,Estrra,NR3B1
    Uniprot Accession P11474
    Uniprot Entry Name ERR1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000173153
    Target Classification Nuclear Receptors

    The protein encoded by this gene is a nuclear receptor that is most closely related to the estrogen receptor. This protein acts as a site-specific transcription factor and interacts with members of the PGC-1 family of transcription cofactors to regulate the expression of most genes involved in cellular energy production as well as in the process of mitochondrial biogenesis. A processed pseudogene of ESRRA is located on chromosome 13q12.1. [provided by RefSeq, Jun 2019]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.