Human NUBPL/C14orf127/huInd1 ORF/cDNA clone-Lentivirus plasmid (NM_025152.3)

Cat. No.: pGMLV001951
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NUBPL/C14orf127/huInd1 Lentiviral expression plasmid for NUBPL lentivirus packaging, NUBPL lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to NUBPL/C14orf127 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $540
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001951
Gene Name NUBPL
Accession Number NM_025152.3
Gene ID 80224
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 960 bp
Gene Alias C14orf127,huInd1,IND1,MC1DN21
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGATTTGGCAGCGTCTGCTGCTTTTTGGTGGGGTGTCGCTCCGGGCTGGTGGCGGGGCCACTGCCCCGCTTGGGGGAAGCCGAGCGATGGTTTGTGGGCGCCAGTTGTCTGGCGCCGGGAGTGAGACCCTAAAACAAAGAAGAACACAAATCATGTCCCGAGGACTTCCAAAGCAGAAACCGATAGAAGGTGTTAAACAAGTTATAGTTGTGGCTTCTGGAAAGGGTGGAGTCGGAAAATCTACTACAGCAGTGAATCTTGCACTTGCACTAGCAGCGAACGATTCGTCCAAGGCCATTGGTTTGCTAGATGTGGATGTGTATGGACCTTCAGTTCCAAAGATGATGAATCTGAAAGGAAATCCGGAATTATCACAGAGCAACCTAATGAGGCCTCTCTTGAATTATGGTATTGCTTGTATGTCTATGGGCTTTCTGGTTGAAGAAAGTGAACCAGTAGTTTGGAGAGGCCTTATGGTAATGTCGGCCATTGAGAAATTGTTGAGGCAGGTAGATTGGGGTCAACTGGACTACTTAGTTGTAGACATGCCACCAGGAACTGGAGATGTGCAGTTATCAGTCTCACAGAATATTCCTATAACAGGTGCTGTGATTGTCTCCACGCCCCAGGACATCGCATTGATGGATGCACACAAGGGTGCTGAGATGTTTCGCAGAGTCCACGTGCCCGTCCTTGGCCTTGTCCAAAACATGAGTGTTTTCCAGTGTCCAAAATGTAAACACAAAACTCATATTTTTGGTGCTGATGGTGCAAGGAAACTAGCACAGACCCTTGGTCTTGAAGTTCTAGGAGACATTCCCTTACACCTTAATATAAGGGAAGCTTCAGATACAGGCCAGCCAATTGTGTTTTCACAGCCTGAAAGTGATGAGGCCAAAGCTTACTTGAGGATTGCTGTGGAAGTGGTAAGAAGATTGCCATCACCTTCAGAATGA
ORF Protein Sequence MGIWQRLLLFGGVSLRAGGGATAPLGGSRAMVCGRQLSGAGSETLKQRRTQIMSRGLPKQKPIEGVKQVIVVASGKGGVGKSTTAVNLALALAANDSSKAIGLLDVDVYGPSVPKMMNLKGNPELSQSNLMRPLLNYGIACMSMGFLVEESEPVVWRGLMVMSAIEKLLRQVDWGQLDYLVVDMPPGTGDVQLSVSQNIPITGAVIVSTPQDIALMDAHKGAEMFRRVHVPVLGLVQNMSVFQCPKCKHKTHIFGADGARKLAQTLGLEVLGDIPLHLNIREASDTGQPIVFSQPESDEAKAYLRIAVEVVRRLPSPSE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2593-Ab Anti-NUBPL/ C14orf127/ IND1 monoclonal antibody
    Target Antigen GM-Tg-g-MP2593-Ag NUBPL VLP (virus-like particle)
    ORF Viral Vector pGMLV001951 Human NUBPL Lentivirus plasmid
    ORF Viral Vector vGMLV001951 Human NUBPL Lentivirus particle


    Target information

    Target ID GM-MP2593
    Target Name NUBPL
    Gene ID 80224, 76826, 717011, 299008, 101088001, 609340, 614641, 100056157
    Gene Symbol and Synonyms 2410170E07Rik,C14orf127,huInd1,IND1,MC1DN21,NUBPL,RGD1307232
    Uniprot Accession Q8TB37
    Uniprot Entry Name NUBPL_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000151413
    Target Classification Not Available

    This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.