Human ASGR1/ASGPR/ASGPR1 ORF/cDNA clone-Lentivirus plasmid (NM_001671.5)

Cat. No.: pGMLV002104
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ASGR1/ASGPR/ASGPR1 Lentiviral expression plasmid for ASGR1 lentivirus packaging, ASGR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ASGR1/ASGPR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $519
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002104
Gene Name ASGR1
Accession Number NM_001671.5
Gene ID 432
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 876 bp
Gene Alias ASGPR,ASGPR1,CLEC4H1,HL-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCAAGGAGTATCAAGACCTTCAGCATCTGGACAATGAGGAGAGTGACCACCATCAGCTCAGAAAAGGGCCACCTCCTCCCCAGCCCCTCCTGCAGCGTCTCTGCTCCGGACCTCGCCTCCTCCTGCTCTCCCTGGGCCTCAGCCTCCTGCTGCTTGTGGTTGTCTGTGTGATCGGATCCCAAAACTCCCAGCTGCAGGAGGAGCTGCGGGGCCTGAGAGAGACGTTCAGCAACTTCACAGCGAGCACGGAGGCCCAGGTCAAGGGCTTGAGCACCCAGGGAGGCAATGTGGGAAGAAAGATGAAGTCGCTAGAGTCCCAGCTGGAGAAACAGCAGAAGGACCTGAGTGAAGATCACTCCAGCCTGCTGCTCCACGTGAAGCAGTTCGTGTCTGACCTGCGGAGCCTGAGCTGTCAGATGGCGGCGCTCCAGGGCAATGGCTCAGAAAGGACCTGCTGCCCGGTCAACTGGGTGGAGCACGAGCGCAGCTGCTACTGGTTCTCTCGCTCCGGGAAGGCCTGGGCTGACGCCGACAACTACTGCCGGCTGGAGGACGCGCACCTGGTGGTGGTCACGTCCTGGGAGGAGCAGAAATTTGTCCAGCACCACATAGGCCCTGTGAACACCTGGATGGGCCTCCACGACCAAAACGGGCCCTGGAAGTGGGTGGACGGGACGGACTACGAGACGGGCTTCAAGAACTGGAGGCCGGAGCAGCCGGACGACTGGTACGGCCACGGGCTCGGAGGAGGCGAGGACTGTGCCCACTTCACCGACGACGGCCGCTGGAACGACGACGTCTGCCAGAGGCCCTACCGCTGGGTCTGCGAGACAGAGCTGGACAAGGCCAGCCAGGAGCCACCTCTCCTTTAA
ORF Protein Sequence MTKEYQDLQHLDNEESDHHQLRKGPPPPQPLLQRLCSGPRLLLLSLGLSLLLLVVVCVIGSQNSQLQEELRGLRETFSNFTASTEAQVKGLSTQGGNVGRKMKSLESQLEKQQKDLSEDHSSLLLHVKQFVSDLRSLSCQMAALQGNGSERTCCPVNWVEHERSCYWFSRSGKAWADADNYCRLEDAHLVVVTSWEEQKFVQHHIGPVNTWMGLHDQNGPWKWVDGTDYETGFKNWRPEQPDDWYGHGLGGGEDCAHFTDDGRWNDDVCQRPYRWVCETELDKASQEPPLL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32780-Ab Anti-ASGR1/ ASGPR/ ASGPR1 monoclonal antibody
    Target Antigen GM-Tg-g-T32780-Ag ASGR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002034 Human ASGR1 Lentivirus plasmid
    ORF Viral Vector pGMLV002104 Human ASGR1 Lentivirus plasmid
    ORF Viral Vector vGMLP002034 Human ASGR1 Lentivirus particle
    ORF Viral Vector vGMLV002104 Human ASGR1 Lentivirus particle


    Target information

    Target ID GM-T32780
    Target Name ASGR1
    Gene ID 432, 721786, 509121, 100061471
    Gene Symbol and Synonyms ASGPR,ASGPR1,ASGR1,CLEC4H1,HL-1
    Uniprot Accession P07306
    Uniprot Entry Name ASGR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000141505
    Target Classification Not Available

    This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.