Human QPRT/HEL-S-90n/QPRTase ORF/cDNA clone-Lentivirus plasmid (NM_014298.6)

Cat. No.: pGMLV002274
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human QPRT/HEL-S-90n/QPRTase Lentiviral expression plasmid for QPRT lentivirus packaging, QPRT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to QPRT/HEL-S-90n products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $523.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002274
Gene Name QPRT
Accession Number NM_014298.6
Gene ID 23475
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 894 bp
Gene Alias HEL-S-90n,QPRTase
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACGCTGAAGGCCTGGCGCTGCTGCTGCCGCCCGTCACCCTGGCAGCCCTGGTGGACAGCTGGCTCCGAGAGGACTGCCCAGGGCTCAACTACGCAGCCTTGGTCAGCGGGGCAGGCCCCTCGCAGGCGGCGCTGTGGGCCAAATCCCCTGGGGTACTGGCAGGGCAGCCTTTCTTCGATGCCATATTTACCCAACTCAACTGCCAAGTCTCCTGGTTCCTCCCCGAGGGATCGAAGCTGGTGCCGGTGGCCAGAGTGGCCGAGGTCCGGGGCCCTGCCCACTGCCTGCTGCTGGGGGAACGGGTGGCCCTCAACACGCTGGCCCGCTGCAGTGGCATTGCCAGTGCTGCCGCCGCTGCAGTGGAGGCCGCCAGGGGGGCCGGCTGGACTGGGCACGTGGCAGGCACGAGGAAGACCACGCCAGGCTTCCGGCTGGTGGAGAAGTATGGGCTCCTGGTGGGCGGGGCCGCCTCGCACCGCTACGACCTGGGAGGGCTGGTGATGGTGAAGGATAACCATGTGGTGGCCGCCGGTGGCGTGGAGAAGGCGGTGCGGGCGGCCAGACAGGCGGCTGACTTCACTCTGAAGGTGGAAGTGGAATGCAGCAGCCTGCAGGAGGCCGTGCAGGCAGCTGAGGCTGGTGCCGACCTTGTCCTGCTGGACAACTTCAAGCCAGAGGAGCTGCACCCCACGGCCACCGTGCTGAAGGCCCAGTTCCCGAGTGTGGCTGTGGAAGCCAGTGGGGGCATCACCCTGGACAACCTCCCCCAGTTCTGCGGGCCGCACATAGACGTCATCTCCATGGGGATGCTGACCCAGGCGGCCCCAGCCCTTGATTTCTCCCTCAAGCTGTTTGCCAAAGAGGTGGCTCCAGTGCCCAAAATCCACTAG
ORF Protein Sequence MDAEGLALLLPPVTLAALVDSWLREDCPGLNYAALVSGAGPSQAALWAKSPGVLAGQPFFDAIFTQLNCQVSWFLPEGSKLVPVARVAEVRGPAHCLLLGERVALNTLARCSGIASAAAAAVEAARGAGWTGHVAGTRKTTPGFRLVEKYGLLVGGAASHRYDLGGLVMVKDNHVVAAGGVEKAVRAARQAADFTLKVEVECSSLQEAVQAAEAGADLVLLDNFKPEELHPTATVLKAQFPSVAVEASGGITLDNLPQFCGPHIDVISMGMLTQAAPALDFSLKLFAKEVAPVPKIH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1390-Ab Anti-NADC/ QPRT/ HEL-S-90nase functional antibody
    Target Antigen GM-Tg-g-SE1390-Ag QPRT protein
    ORF Viral Vector pGMLV002274 Human QPRT Lentivirus plasmid
    ORF Viral Vector vGMLV002274 Human QPRT Lentivirus particle


    Target information

    Target ID GM-SE1390
    Target Name QPRT
    Gene ID 23475, 67375, 708784, 293504, 101087441, 607664, 614254, 100065768
    Gene Symbol and Synonyms 2410027J01Rik,HEL-S-90n,QPRT,QPRTase
    Uniprot Accession Q15274
    Uniprot Entry Name NADC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000103485
    Target Classification Not Available

    This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.