Human NR1H3/LXR-a/LXRA ORF/cDNA clone-Lentivirus plasmid (NM_005693.4)

Cat. No.: pGMLV002340
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NR1H3/LXR-a/LXRA Lentiviral expression plasmid for NR1H3 lentivirus packaging, NR1H3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NR1H3/LXR-a products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $676.32
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002340
Gene Name NR1H3
Accession Number NM_005693.4
Gene ID 10062
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1344 bp
Gene Alias LXR-a,LXRA,RLD-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCTTGTGGCTGGGGGCCCCTGTGCCTGACATTCCTCCTGACTCTGCGGTGGAGCTGTGGAAGCCAGGCGCACAGGATGCAAGCAGCCAGGCCCAGGGAGGCAGCAGCTGCATCCTCAGAGAGGAAGCCAGGATGCCCCACTCTGCTGGGGGTACTGCAGGGGTGGGGCTGGAGGCTGCAGAGCCCACAGCCCTGCTCACCAGGGCAGAGCCCCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAAAAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCCTCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGCGTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTACATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAGGAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAACAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAGCTCAGCCCGGAACAACTGGGCATGATCGAGAAGCTCGTCGCTGCCCAGCAACAGTGTAACCGGCGCTCCTTTTCTGACCGGCTTCGAGTCACGCCTTGGCCCATGGCACCAGATCCCCATAGCCGGGAGGCCCGTCAGCAGCGCTTTGCCCACTTCACTGAGCTGGCCATCGTCTCTGTGCAGGAGATAGTTGACTTTGCTAAACAGCTACCCGGCTTCCTGCAGCTCAGCCGGGAGGACCAGATTGCCCTGCTGAAGACCTCTGCGATCGAGGTGATGCTTCTGGAGACATCTCGGAGGTACAACCCTGGGAGTGAGAGTATCACCTTCCTCAAGGATTTCAGTTATAACCGGGAAGACTTTGCCAAAGCAGGGCTGCAAGTGGAATTCATCAACCCCATCTTCGAGTTCTCCAGGGCCATGAATGAGCTGCAACTCAATGATGCCGAGTTTGCCTTGCTCATTGCTATCAGCATCTTCTCTGCAGACCGGCCCAACGTGCAGGACCAGCTCCAGGTAGAGAGGCTGCAGCACACATATGTGGAAGCCCTGCATGCCTACGTCTCCATCCACCATCCCCATGACCGACTGATGTTCCCACGGATGCTAATGAAACTGGTGAGCCTCCGGACCCTGAGCAGCGTCCACTCAGAGCAAGTGTTTGCACTGCGTCTGCAGGACAAAAAGCTCCCACCGCTGCTCTCTGAGATCTGGGATGTGCACGAATGA
ORF Protein Sequence MSLWLGAPVPDIPPDSAVELWKPGAQDASSQAQGGSSCILREEARMPHSAGGTAGVGLEAAEPTALLTRAEPPSEPTEIRPQKRKKGPAPKMLGNELCSVCGDKASGFHYNVLSCEGCKGFFRRSVIKGAHYICHSGGHCPMDTYMRRKCQECRLRKCRQAGMREECVLSEEQIRLKKLKRQEEEQAHATSLPPRASSPPQILPQLSPEQLGMIEKLVAAQQQCNRRSFSDRLRVTPWPMAPDPHSREARQQRFAHFTELAIVSVQEIVDFAKQLPGFLQLSREDQIALLKTSAIEVMLLETSRRYNPGSESITFLKDFSYNREDFAKAGLQVEFINPIFEFSRAMNELQLNDAEFALLIAISIFSADRPNVQDQLQVERLQHTYVEALHAYVSIHHPHDRLMFPRMLMKLVSLRTLSSVHSEQVFALRLQDKKLPPLLSEIWDVHE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T52297-Ab Anti-NR1H3 monoclonal antibody
    Target Antigen GM-Tg-g-T52297-Ag NR1H3 protein
    ORF Viral Vector pGMLP001408 Human NR1H3 Lentivirus plasmid
    ORF Viral Vector pGMLV002334 Human NR1H3 Lentivirus plasmid
    ORF Viral Vector pGMLV002340 Human NR1H3 Lentivirus plasmid
    ORF Viral Vector vGMLP001408 Human NR1H3 Lentivirus particle
    ORF Viral Vector vGMLV002334 Human NR1H3 Lentivirus particle
    ORF Viral Vector vGMLV002340 Human NR1H3 Lentivirus particle


    Target information

    Target ID GM-T52297
    Target Name NR1H3
    Gene ID 10062, 22259, 713679, 58852, 101092889, 483625, 507176, 100051253
    Gene Symbol and Synonyms LXR,LXR-a,LXRA,LXRalpha,NR1H3,RLD-1,RLD1,Unr1
    Uniprot Accession Q13133
    Uniprot Entry Name NR1H3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000025434
    Target Classification Checkpoint-Immuno Oncology, Nuclear Receptors

    The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.