Human FADS1/D5D/FADS6 ORF/cDNA clone-Lentivirus plasmid (NM_013402.7)

Cat. No.: pGMLV002389
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FADS1/D5D/FADS6 Lentiviral expression plasmid for FADS1 lentivirus packaging, FADS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to FADS1/D5D products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $766.86
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002389
Gene Name FADS1
Accession Number NM_013402.7
Gene ID 3992
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1506 bp
Gene Alias D5D,FADS6,FADSD5,LLCDL1,TU12
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGAACGCGCGCTGCGAGGCCCGCCGGTCTGCCCTGCGGTGCTGAAAACCCGGCGCGCAGGCGGCTGGCTCTGGGCGCGCGCCAGCAAATCCACTCCTGGAGCCCGCGGACCCCGAGCACGCGCCTGACAGCCCCTGCTGGCCCGGCGCGCGGCGTCGCCAGGCCAGCTATGGCCCCCGACCCGGTGGCCGCCGAGACCGCGGCTCAGGGACCTACCCCGCGCTACTTCACCTGGGACGAGGTGGCCCAGCGCTCAGGGTGCGAGGAGCGGTGGCTAGTGATCGACCGTAAGGTGTACAACATCAGCGAGTTCACCCGCCGGCATCCAGGGGGCTCCCGGGTCATCAGCCACTACGCCGGGCAGGATGCCACGGATCCCTTTGTGGCCTTCCACATCAACAAGGGCCTTGTGAAGAAGTATATGAACTCTCTCCTGATTGGAGAACTGTCTCCAGAGCAGCCCAGCTTTGAGCCCACCAAGAATAAAGAGCTGACAGATGAGTTCCGGGAGCTGCGGGCCACAGTGGAGCGGATGGGGCTCATGAAGGCCAACCATGTCTTCTTCCTGCTGTACCTGCTGCACATCTTGCTGCTGGATGGTGCAGCCTGGCTCACCCTTTGGGTCTTTGGGACGTCCTTTTTGCCCTTCCTCCTCTGTGCGGTGCTGCTCAGTGCAGTTCAGGCCCAGGCTGGCTGGCTGCAGCATGACTTTGGGCACCTGTCGGTCTTCAGCACCTCAAAGTGGAACCATCTGCTACATCATTTTGTGATTGGCCACCTGAAGGGGGCCCCCGCCAGTTGGTGGAACCACATGCACTTCCAGCACCATGCCAAGCCCAACTGCTTCCGCAAAGACCCAGACATCAACATGCATCCCTTCTTCTTTGCCTTGGGGAAGATCCTCTCTGTGGAGCTTGGGAAACAGAAGAAAAAATATATGCCGTACAACCACCAGCACAAATACTTCTTCCTAATTGGGCCCCCAGCCTTGCTGCCTCTCTACTTCCAGTGGTATATTTTCTATTTTGTTATCCAGCGAAAGAAGTGGGTGGACTTGGCCTGGATGATTACCTTCTACGTCCGCTTCTTCCTCACTTATGTGCCACTATTGGGGCTGAAAGCCTTCCTGGGCCTTTTCTTCATAGTCAGGTTCCTGGAAAGCAACTGGTTTGTGTGGGTGACACAGATGAACCATATTCCCATGCACATTGATCATGACCGGAACATGGACTGGGTTTCCACCCAGCTCCAGGCCACATGCAATGTCCACAAGTCTGCCTTCAATGACTGGTTCAGTGGACACCTCAACTTCCAGATTGAGCACCATCTTTTTCCCACGATGCCTCGACACAATTACCACAAAGTGGCTCCCCTGGTGCAGTCCTTGTGTGCCAAGCATGGCATAGAGTACCAGTCCAAGCCCCTGCTGTCAGCCTTCGCCGACATCATCCACTCACTAAAGGAGTCAGGGCAGCTCTGGCTAGATGCCTATCTTCACCAATAA
ORF Protein Sequence MGTRAARPAGLPCGAENPARRRLALGARQQIHSWSPRTPSTRLTAPAGPARGVARPAMAPDPVAAETAAQGPTPRYFTWDEVAQRSGCEERWLVIDRKVYNISEFTRRHPGGSRVISHYAGQDATDPFVAFHINKGLVKKYMNSLLIGELSPEQPSFEPTKNKELTDEFRELRATVERMGLMKANHVFFLLYLLHILLLDGAAWLTLWVFGTSFLPFLLCAVLLSAVQAQAGWLQHDFGHLSVFSTSKWNHLLHHFVIGHLKGAPASWWNHMHFQHHAKPNCFRKDPDINMHPFFFALGKILSVELGKQKKKYMPYNHQHKYFFLIGPPALLPLYFQWYIFYFVIQRKKWVDLAWMITFYVRFFLTYVPLLGLKAFLGLFFIVRFLESNWFVWVTQMNHIPMHIDHDRNMDWVSTQLQATCNVHKSAFNDWFSGHLNFQIEHHLFPTMPRHNYHKVAPLVQSLCAKHGIEYQSKPLLSAFADIIHSLKESGQLWLDAYLHQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0787-Ab Anti-FADS1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0787-Ag FADS1 protein
    ORF Viral Vector pGMLV002389 Human FADS1 Lentivirus plasmid
    ORF Viral Vector vGMLV002389 Human FADS1 Lentivirus particle


    Target information

    Target ID GM-IP0787
    Target Name FADS1
    Gene ID 3992, 76267, 722343, 84575, 101083966, 483793, 533107, 102150261
    Gene Symbol and Synonyms 0710001O03Rik,A930006B21Rik,D5D,DSD,FADS1,FADS6,FADSD5,LLCDL1,TU12
    Uniprot Accession O60427
    Uniprot Entry Name FADS1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000149485
    Target Classification Not Available

    The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.