Human SCGB1A1/CC10/CC16 ORF/cDNA clone-Lentivirus plasmid (NM_003357)
Cat. No.: pGMLV002440
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SCGB1A1/CC10/CC16 Lentiviral expression plasmid for SCGB1A1 lentivirus packaging, SCGB1A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SCGB1A1/CC10 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV002440 |
| Gene Name | SCGB1A1 |
| Accession Number | NM_003357 |
| Gene ID | 7356 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 276 bp |
| Gene Alias | CC10,CC16,CCPBP,CCSP,UGB,UP-1,UP1 |
| Fluorescent Reporter | Null |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAACTCGCTGTCACCCTCACCCTGGTCACACTGGCTCTCTGCTGCAGCTCCGCTTCTGCAGAGATCTGCCCGAGCTTTCAGCGTGTCATCGAAACCCTCCTCATGGACACACCCTCCAGTTATGAGGCTGCCATGGAACTTTTCAGCCCTGATCAAGACATGAGGGAGGCAGGGGCTCAGCTGAAGAAGCTGGTGGACACCCTCCCCCAAAAGCCCAGAGAAAGCATCATTAAGCTCATGGAAAAAATAGCCCAAAGCTCACTGTGTAATTAG |
| ORF Protein Sequence | MKLAVTLTLVTLALCCSSASAEICPSFQRVIETLLMDTPSSYEAAMELFSPDQDMREAGAQLKKLVDTLPQKPRESIIKLMEKIAQSSLCN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T93484-Ab | Anti-UTER/ SCGB1A1/ CC10 functional antibody |
| Target Antigen | GM-Tg-g-T93484-Ag | SCGB1A1 protein |
| ORF Viral Vector | pGMLP000065 | Human SCGB1A1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV002440 | Human SCGB1A1 Lentivirus plasmid |
| ORF Viral Vector | vGMLP000065 | Human SCGB1A1 Lentivirus particle |
| ORF Viral Vector | vGMLV002440 | Human SCGB1A1 Lentivirus particle |
Target information
| Target ID | GM-T93484 |
| Target Name | SCGB1A1 |
| Gene ID | 7356, 22287, 718857, 25575, 101087523, 476060, 767867, 100060053 |
| Gene Symbol and Synonyms | CC10,CC16,CCPBP,CCSP,PCB-BP,PCBB,SCGB1A1,UG,UGB,UGL,UP-1,UP1,Utg |
| Uniprot Accession | P11684 |
| Uniprot Entry Name | UTER_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Dent disease |
| Gene Ensembl | ENSG00000149021 |
| Target Classification | Not Available |
This gene encodes a member of the secretoglobin family of small secreted proteins. The encoded protein has been implicated in numerous functions including anti-inflammation, inhibition of phospholipase A2 and the sequestering of hydrophobic ligands. Defects in this gene are associated with a susceptibility to asthma. [provided by RefSeq, May 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


