Human SCGB1A1/CC10/CC16 ORF/cDNA clone-Lentivirus particle (NM_003357)

Cat. No.: vGMLV002440

Pre-made Human SCGB1A1/CC10/CC16 Lentiviral expression plasmid for SCGB1A1 lentivirus packaging, SCGB1A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SCGB1A1/CC10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV002440 Human SCGB1A1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV002440
Gene Name SCGB1A1
Accession Number NM_003357
Gene ID 7356
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 276 bp
Gene Alias CC10,CC16,CCPBP,CCSP,UGB,UP-1,UP1
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAACTCGCTGTCACCCTCACCCTGGTCACACTGGCTCTCTGCTGCAGCTCCGCTTCTGCAGAGATCTGCCCGAGCTTTCAGCGTGTCATCGAAACCCTCCTCATGGACACACCCTCCAGTTATGAGGCTGCCATGGAACTTTTCAGCCCTGATCAAGACATGAGGGAGGCAGGGGCTCAGCTGAAGAAGCTGGTGGACACCCTCCCCCAAAAGCCCAGAGAAAGCATCATTAAGCTCATGGAAAAAATAGCCCAAAGCTCACTGTGTAATTAG
ORF Protein Sequence MKLAVTLTLVTLALCCSSASAEICPSFQRVIETLLMDTPSSYEAAMELFSPDQDMREAGAQLKKLVDTLPQKPRESIIKLMEKIAQSSLCN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T93484-Ab Anti-UTER/ SCGB1A1/ CC10 functional antibody
    Target Antigen GM-Tg-g-T93484-Ag SCGB1A1 protein
    ORF Viral Vector pGMLP000065 Human SCGB1A1 Lentivirus plasmid
    ORF Viral Vector pGMLV002440 Human SCGB1A1 Lentivirus plasmid
    ORF Viral Vector vGMLP000065 Human SCGB1A1 Lentivirus particle
    ORF Viral Vector vGMLV002440 Human SCGB1A1 Lentivirus particle


    Target information

    Target ID GM-T93484
    Target Name SCGB1A1
    Gene ID 7356, 22287, 718857, 25575, 101087523, 476060, 767867, 100060053
    Gene Symbol and Synonyms CC10,CC16,CCPBP,CCSP,PCB-BP,PCBB,SCGB1A1,UG,UGB,UGL,UP-1,UP1,Utg
    Uniprot Accession P11684
    Uniprot Entry Name UTER_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Dent disease
    Gene Ensembl ENSG00000149021
    Target Classification Not Available

    This gene encodes a member of the secretoglobin family of small secreted proteins. The encoded protein has been implicated in numerous functions including anti-inflammation, inhibition of phospholipase A2 and the sequestering of hydrophobic ligands. Defects in this gene are associated with a susceptibility to asthma. [provided by RefSeq, May 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.