Human IL33/C9orf26/ DVS27 ORF/cDNA clone-Adenovirus particle (NM_033439)

Pre-made Human IL33/C9orf26/ DVS27 Adenovirus for IL33 overexpression in-vitro and in-vivo. The IL33 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL33-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to IL33/C9orf26 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP-IL-120 Human IL33 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP-IL-120
Gene Name IL33
Accession Number NM_033439
Gene ID 90865
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 813 bp
Gene Alias C9orf26, DVS27, IL1F11, NF-HEV, NFEHEV
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGCCTAAAATGAAGTATTCAACCAACAAAATTTCCACAGCAAAGTGGAAGAACACAGCAAGCAAAGCCTTGTGTTTCAAGCTGGGAAAATCCCAACAGAAGGCCAAAGAAGTTTGCCCCATGTACTTTATGAAGCTCCGCTCTGGCCTTATGATAAAAAAGGAGGCCTGTTACTTTAGGAGAGAAACCACCAAAAGGCCTTCACTGAAAACAGGTAGAAAGCACAAAAGACATCTGGTACTCGCTGCCTGTCAACAGCAGTCTACTGTGGAGTGCTTTGCCTTTGGTATATCAGGGGTCCAGAAATATACTAGAGCACTTCATGATTCAAGTATCACAGGAATTTCACCTATTACAGAGTATCTTGCTTCTCTAAGCACATACAATGATCAATCCATTACTTTTGCTTTGGAGGATGAAAGTTATGAGATATATGTTGAAGACTTGAAAAAAGATGAAAAGAAAGATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-591 Pre-Made Tozorakimab biosimilar, Whole mAb, Anti-IL33 Antibody: Anti-C9orf26/DVS27/IL1F11/NF-HEV/NFEHEV therapeutic antibody
    Biosimilar GMP-Bios-ab-588 Pre-Made Torudokimab biosimilar, Whole mAb, Anti-IL33 Antibody: Anti-C9orf26/DVS27/IL1F11/NF-HEV/NFEHEV therapeutic antibody
    Biosimilar GMP-Bios-ab-283 Pre-Made Itepekimab biosimilar, Whole mAb, Anti-IL33 Antibody: Anti-C9orf26/DVS27/IL1F11/NF-HEV/NFEHEV therapeutic antibody
    Target Antibody GM-Tg-g-T23797-Ab Anti-IL33/ C9orf26/ DVS27 functional antibody
    Target Antigen GM-Tg-g-T23797-Ag IL33 protein
    Cytokine cks-Tg-g-GM-T23797 Interleukin 33 (IL33) protein & antibody
    ORF Viral Vector pGMLV000045 Human IL33 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-037 Human IL33 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-120 Human IL33 Adenovirus plasmid
    ORF Viral Vector vGMLV000045 Human IL33 Lentivirus particle
    ORF Viral Vector vGMLP-IL-037 Human IL33 Lentivirus particle
    ORF Viral Vector vGMAP-IL-120 Human IL33 Adenovirus particle


    Target information

    Target ID GM-T23797
    Target Name IL33
    Gene ID 90865, 77125, 717301, 361749, 101093403, 403810, 507054, 100059908
    Gene Symbol and Synonyms 9230117N10Rik,C9orf26,DVS27,Il-33,IL1F11,IL33,NF-HEV,NFEHEV,RGD1311155
    Uniprot Accession O95760
    Uniprot Entry Name IL33_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000137033
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.