Human IL33/C9orf26/DVS27 ORF/cDNA clone-Adenovirus particle (NM_033439)
Cat. No.: vGMAP-IL-120
Pre-made Human IL33/C9orf26/DVS27 Adenovirus for IL33 overexpression in-vitro and in-vivo. The IL33 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL33-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IL33/C9orf26 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-IL-120 | Human IL33 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-IL-120 |
| Gene Name | IL33 |
| Accession Number | NM_033439 |
| Gene ID | 90865 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 813 bp |
| Gene Alias | C9orf26,DVS27,IL1F11,NF-HEV,NFEHEV |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGAAGCCTAAAATGAAGTATTCAACCAACAAAATTTCCACAGCAAAGTGGAAGAACACAGCAAGCAAAGCCTTGTGTTTCAAGCTGGGAAAATCCCAACAGAAGGCCAAAGAAGTTTGCCCCATGTACTTTATGAAGCTCCGCTCTGGCCTTATGATAAAAAAGGAGGCCTGTTACTTTAGGAGAGAAACCACCAAAAGGCCTTCACTGAAAACAGGTAGAAAGCACAAAAGACATCTGGTACTCGCTGCCTGTCAACAGCAGTCTACTGTGGAGTGCTTTGCCTTTGGTATATCAGGGGTCCAGAAATATACTAGAGCACTTCATGATTCAAGTATCACAGGAATTTCACCTATTACAGAGTATCTTGCTTCTCTAAGCACATACAATGATCAATCCATTACTTTTGCTTTGGAGGATGAAAGTTATGAGATATATGTTGAAGACTTGAAAAAAGATGAAAAGAAAGATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAG |
| ORF Protein Sequence | MKPKMKYSTNKISTAKWKNTASKALCFKLGKSQQKAKEVCPMYFMKLRSGLMIKKEACYFRRETTKRPSLKTGRKHKRHLVLAACQQQSTVECFAFGISGVQKYTRALHDSSITGISPITEYLASLSTYNDQSITFALEDESYEIYVEDLKKDEKKDKVLLSYYESQHPSNESGDGVDGKMLMVTLSPTKDFWLHANNKEHSVELHKCEKPLPDQAFFVLHNMHSNCVSFECKTDPGVFIGVKDNHLALIKVDSSENLCTENILFKLSET |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T23797 |
| Target Name | IL33 |
| Gene ID | 90865, 77125, 717301, 361749, 101093403, 403810, 507054, 100059908 |
| Gene Symbol and Synonyms | 9230117N10Rik,C9orf26,DVS27,Il-33,IL1F11,IL33,NF-HEV,NFEHEV,RGD1311155 |
| Uniprot Accession | O95760 |
| Uniprot Entry Name | IL33_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, INN Index, Cytokine Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000137033 |
| Target Classification | Not Available |
The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


