Human G6PD/G6PD1 ORF/cDNA clone-Adenovirus particle (BC000337)

Pre-made Human G6PD/G6PD1 Adenovirus for G6PD overexpression in-vitro and in-vivo. The G6PD adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified G6PD-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to G6PD/G6PD1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000116 Human G6PD Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000116
Gene Name G6PD
Accession Number BC000337
Gene ID 2539
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1548 bp
Gene Alias G6PD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGAGCAGGTGGCCCTGAGCCGGACCCAGGTGTGCGGGATCCTGCGGGAAGAGCTTTTCCAGGGCGATGCCTTCCATCAGTCGGATACACACATATTCATCATCATGGGTGCATCGGGTGACCTGGCCAAGAAGAAGATCTACCCCACCATCTGGTGGCTGTTCCGGGATGGCCTTCTGCCCGAAAACACCTTCATCGTGGGCTATGCCCGTTCCCGCCTCACAGTGGCTGACATCCGCAAACAGAGTGAGCCCTTCTTCAAGGCCACCCCAGAGGAGAAGCTCAAGCTGGAGGACTTCTTTGCCCGCAACTCCTATGTGGCTGGCCAGTACGATGATGCAGCCTCCTACCAGCGCCTCAACAGCCACATGAATGCCCTCCACCTGGGGTCACAGGCCAACCGCCTCTTCTACCTGGCCTTGCCCCCGACCGTCTACGAGGCCGTCACCAAGAACATTCACGAGTCCTGCATGAGCCAGATAGGCTGGAACCGCATCATCGTGGAGAAGCCCTTCGGGAGGGACCTGCAGAGCTCTGACCGGCTGTCCAACCACATCTCCTCCCTGTTCCGTGAGGACCAGATCTACCGCATCGACCACTACCTGGGCAAGGAGATGGTGCAGAACCTCATGGTGCTGAGATTTGCCAACAGGATCTTCGGCCCCATCTGGAACCGGGACAACATCGCCTGCGTTATCCTCACCTTCAAGGAGCCCTTTGGCACTGAGGGTCGCGGGGGCTATTTCGATGAATTTGGGATCATCCGGGACGTGATGCAGAACCACCTACTGCAGATGCTGTGTCTGGTGGCCATGGAGAAGCCCGCCTCCACCAACTCAGATGACGTCCGTGATGAGAAGGTCAAGGTGTTGAAATGCATCTCAGAGGTGCAGGCCAACAATGTGGTCCTGGGCCAGTACGTGGGGAACCCCGATGGAGAGGGCGAGGCCACCAAAGGGTACCTGGACGACCCCACGGTGCCCCGCGGGTCCACCACCGCCACTTTTGCAGCCGTCGTCCTCTATGTGGAGAATGAGAGGTGGGATGGGGTGCCCTTCATCCTGCGCTGCGGCAAGGCCCTGAACGAGCGCAAGGCCGAGGTGAGGCTGCAGTTCCATGATGTGGCCGGCGACATCTTCCACCAGCAGTGCAAGCGCAACGAGCTGGTGATCCGCGTGCAGCCCAACGAGGCCGTGTACACCAAGATGATGACCAAGAAGCCGGGCATGTTCTTCAACCCCGAGGAGTCGGAGCTGGACCTGACCTACGGCAACAGATACAAGAACGTGAAGCTCCCTGACGCCTATGAGCGCCTCATCCTGGACGTCTTCTGCGGGAGCCAGATGCACTTCGTGCGCAGCGACGAGCTCCGTGAGGCCTGGCGTATTTTCACCCCACTGCTGCACCAGATTGAGCTGGAGAAGCCCAAGCCCATCCCCTATATTTATGGCAGCCGAGGCCCCACGGAGGCAGACGAGCTGATGAAGAGAGTGGGTTTCCAGTATGAGGGCACCTACAAGTGGGTGAACCCCCACAAGCTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T63484-Ab Anti-G6PD monoclonal antibody
    Target Antigen GM-Tg-g-T63484-Ag G6PD protein
    ORF Viral Vector pGMAD001189 Rat G6pd Adenovirus plasmid
    ORF Viral Vector pGMPC000740 Human G6PD Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000926 Human G6PD Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000509 Human G6PD Lentivirus plasmid
    ORF Viral Vector pGMAP000116 Human G6PD Adenovirus plasmid
    ORF Viral Vector vGMAD001189 Rat G6pd Adenovirus particle
    ORF Viral Vector vGMLP000509 Human G6PD Lentivirus particle
    ORF Viral Vector vGMAP000116 Human G6PD Adenovirus particle
    ORF Viral Vector pGMLV002102 Human G6PD Lentivirus plasmid


    Target information

    Target ID GM-T63484
    Target Name G6PD
    Gene ID 2539, 14381, 701137, 24377, 100270776, 119868559, 281179, 100059734
    Gene Symbol and Synonyms G28A,G6PD,G6PD1,G6pdx,Gpdx
    Uniprot Accession P11413
    Uniprot Entry Name G6PD_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000160211
    Target Classification Not Available

    This gene encodes glucose-6-phosphate dehydrogenase. This protein is a cytosolic enzyme encoded by a housekeeping X-linked gene whose main function is to produce NADPH, a key electron donor in the defense against oxidizing agents and in reductive biosynthetic reactions. G6PD is remarkable for its genetic diversity. Many variants of G6PD, mostly produced from missense mutations, have been described with wide ranging levels of enzyme activity and associated clinical symptoms. G6PD deficiency may cause neonatal jaundice, acute hemolysis, or severe chronic non-spherocytic hemolytic anemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.