Human GCK/GK/ GLK ORF/cDNA clone-Adenovirus particle (BC001890)

Pre-made Human GCK/GK/ GLK Adenovirus for GCK overexpression in-vitro and in-vivo. The GCK adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GCK-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to GCK/GK products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000134 Human GCK Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000134
Gene Name GCK
Accession Number BC001890
Gene ID 2645
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1398 bp
Gene Alias GK, GLK, HHF3, HK4, HKIV, HXKP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGGACGACAGAGCCAGGATGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGGAGGACCTGAAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGGAGACCCATGAAGAGGCCAGTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAGGCTCAGAAGTCGGGGACTTCCTCTCCCTGGACCTGGGTGGCACTAACTTCAGGGTGATGCTGGTGAAGGTGGGAGAAGGTGAGGAGGGGCAGTGGAGCGTGAAGACCAAACACCAGATGTACTCCATCCCCGAGGACGCCATGACCGGCACTGCTGAGATGCTCTTCGACTACATCTCTGAGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAACACAAGAAGCTGCCCCTGGGCTTCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCCTTCTCAACTGGACCAAGGGCTTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGACGCTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGGCCACGATGATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCATGATCGTGGGCACGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTGGTGGAGGGGGACGAGGGCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCGGCGAGCTGGACGAGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGCTCTGCAAACCCCGGTCAGCAGCTGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGCTTGTGCTGCTCAGGCTCGTGGACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCGGAGCCTTCGAGACGCGCTTCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGATCTACAACATCCTGAGCACGCTGGGGCTGCGACCCTCGACCACCGACTGCGACATCGTGCGCCGCGCCTGCGAGAGCGTGTCTACGCGCGCTGCGCACATGTGCTCGGCGGGGCTGGCGGGCGTCATCAACCGCATGCGCGAGAGCCGCAGCGAGGACGTAATGCGCATCACTGTGGGCGTGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAGGAGCGGTTCCATGCCAGCGTGCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGGGCGCGGCCCTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T87166-Ab Anti-GCK monoclonal antibody
    Target Antigen GM-Tg-g-T87166-Ag GCK protein
    ORF Viral Vector pGMPC000035 Human GCK Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000134 Human GCK Adenovirus plasmid
    ORF Viral Vector vGMAP000134 Human GCK Adenovirus particle


    Target information

    Target ID GM-T87166
    Target Name GCK
    Gene ID 2645, 103988, 699728, 24385, 100037406, 606490, 616576
    Gene Symbol and Synonyms FGQTL3,GCK,GK,GLK,Gls006,GLUKA,HHF3,HK4,HKIV,Hlb62,HXKP,LGLK,MODY2,PNDM1,RNGK2
    Uniprot Accession P35557
    Uniprot Entry Name HXK4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000106633
    Target Classification Not Available

    This gene encodes a member of the hexokinase family of proteins. Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. The use of multiple promoters and alternative splicing of this gene result in distinct protein isoforms that exhibit tissue-specific expression in the pancreas and liver. In the pancreas, this enzyme plays a role in glucose-stimulated insulin secretion, while in the liver, this enzyme is important in glucose uptake and conversion to glycogen. Mutations in this gene that alter enzyme activity have been associated with multiple types of diabetes and hyperinsulinemic hypoglycemia. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.