Human NRP1/CD304/ NRP ORF/cDNA clone-Adenovirus particle (BC007737)
Pre-made Human NRP1/CD304/ NRP Adenovirus for NRP1 overexpression in-vitro and in-vivo. The NRP1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified NRP1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to NRP1/CD304 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000141 | Human NRP1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000141 |
Gene Name | NRP1 |
Accession Number | BC007737 |
Gene ID | 8829 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1830 bp |
Gene Alias | CD304, NRP, VEGF165R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGAGGGGGCTGCCGCTCCTCTGCGCCGTGCTCGCCCTCGTCCTCGCCCCGGCCGGCGCTTTTCGCAACGATAAATGTGGCGATACTATAAAAATTGAAAGCCCCGGGTACCTTACATCTCCTGGTTATCCTCATTCTTATCACCCAAGTGAAAAATGCGAATGGCTGATTCAGGCTCCGGACCCATACCAGAGAATTATGATCAACTTCAACCCTCACTTCGATTTGGAGGACAGAGACTGCAAGTATGACTACGTGGAAGTCTTCGATGGAGAAAATGAAAATGGACATTTTAGGGGAAAGTTCTGTGGAAAGATAGCCCCTCCTCCTGTTGTGTCTTCAGGGCCATTTCTTTTTATCAAATTTGTCTCTGACTACGAAACACATGGTGCAGGATTTTCCATACGTTATGAAATTTTCAAGAGAGGTCCTGAATGTTCCCAGAACTACACAACACCTAGTGGAGTGATAAAGTCCCCCGGATTCCCTGAAAAATATCCCAACAGCCTTGAATGCACTTATATTGTCTTTGCGCCAAAGATGTCAGAGATTATCCTGGAATTTGAAAGCTTTGACCTGGAGCCTGACTCAAATCCTCCAGGGGGGATGTTCTGTCGCTACGACCGGCTAGAAATCTGGGATGGATTCCCTGATGTTGGCCCTCACATTGGGCGTTACTGTGGACAGAAAACACCAGGTCGAATCCGATCCTCATCGGGCATTCTCTCCATGGTTTTTTACACCGACAGCGCGATAGCAAAAGAAGGTTTCTCAGCAAACTACAGTGTCTTGCAGAGCAGTGTCTCAGAAGATTTCAAATGTATGGAAGCTCTGGGCATGGAATCAGGAGAAATTCATTCTGACCAGATCACAGCTTCTTCCCAGTATAGCACCAACTGGTCTGCAGAGCGCTCCCGCCTGAACTACCCTGAGAATGGGTGGACTCCCGGAGAGGATTCCTACCGAGAGTGGATACAGGTAGACTTGGGCCTTCTGCGCTTTGTCACGGCTGTCGGGACACAGGGCGCCATTTCAAAAGAAACCAAGAAGAAATATTATGTCAAGACTTACAAGATCGACGTTAGCTCCAACGGGGAAGACTGGATCACCATAAAAGAAGGAAACAAACCTGTTCTCTTTCAGGGAAACACCAACCCCACAGATGTTGTGGTTGCAGTATTCCCCAAACCACTGATAACTCGATTTGTCCGAATCAAGCCTGCAACTTGGGAAACTGGCATATCTATGAGATTTGAAGTATACGGTTGCAAGATAACAGATTATCCTTGCTCTGGAATGTTGGGTATGGTGTCTGGACTTATTTCTGACTCCCAGATCACATCATCCAACCAAGGGGACAGAAACTGGATGCCTGAAAACATCCGCCTGGTAACCAGTCGCTCTGGCTGGGCACTTCCACCCGCACCTCATTCCTACATCAATGAGTGGCTCCAAATAGACCTGGGGGAGGAGAAGATCGTGAGGGGCATCATCATTCAGGGTGGGAAGCACCGAGAGAACAAGGTGTTCATGAGGAAGTTCAAGATCGGGTACAGCAACAACGGCTCGGACTGGAAGATGATCATGGATGACAGCAAACGCAAGGCGAAGTCTTTTGAGGGCAACAACAACTATGATACACCTGAGCTGCGGACTTTTCCAGCTCTCTCCACGCGATTCATCAGGATCTACCCCGAGAGAGCCACTCATGGCGGACTGGGGCTCAGAATGGAGCTGCTGGGCTGTGAAGTGGAAGGTGGCACCACTGTGCTGGCCACAGAAAAGCCCACGGTCATAGACAGCACCATACAATCAGGTATCAAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-618 | Pre-Made Vesencumab biosimilar, Whole mAb, Anti-NRP1 Antibody: Anti-BDCA4/CD304/NP1/NRP/VEGF165R therapeutic antibody |
Target Antibody | GM-Tg-g-T15023-Ab | Anti-NRP1/ BDCA4/ CD304 monoclonal antibody |
Target Antigen | GM-Tg-g-T15023-Ag | NRP1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV001415 | Rat Nrp1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001533 | Rat Nrp1 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000733 | Rat Nrp1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000141 | Human NRP1 Adenovirus plasmid |
ORF Viral Vector | vGMLV001415 | Rat Nrp1 Lentivirus particle |
ORF Viral Vector | vGMLV001533 | Rat Nrp1 Lentivirus particle |
ORF Viral Vector | vGMAAV000733 | Rat Nrp1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000141 | Human NRP1 Adenovirus particle |
ORF Viral Vector | pGMLV002124 | Human NRP1 Lentivirus plasmid |
Target information
Target ID | GM-T15023 |
Target Name | NRP1 |
Gene ID | 8829, 18186, 697755, 246331, 101094027, 477955, 539369, 100060430 |
Gene Symbol and Synonyms | BDCA4,C530029I03,CD304,NP-1,NP1,NPN-1,Npn1,NRP,NRP1,VEGF165R |
Uniprot Accession | O14786 |
Uniprot Entry Name | NRP1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Cancer |
Gene Ensembl | ENSG00000099250 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. This protein has also been determined to act as a co-receptor for SARS-CoV-2 (which causes COVID-19) to infect host cells. [provided by RefSeq, Nov 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.