Human FHL1/bA535K18.1/FHL1B ORF/cDNA clone-Adenovirus particle (BC010998)
Cat. No.: vGMAP000161
Pre-made Human FHL1/bA535K18.1/FHL1B Adenovirus for FHL1 overexpression in-vitro and in-vivo. The FHL1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified FHL1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
FHL1/bA535K18.1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000161 | Human FHL1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000161 |
| Gene Name | FHL1 |
| Accession Number | BC010998 |
| Gene ID | 2273 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 843 bp |
| Gene Alias | bA535K18.1,FHL1B,KYO-T,SLIM1 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGCGGAGAAGTTTGACTGCCACTACTGCAGGGATCCCTTGCAGGGGAAGAAGTATGTGCAAAAGGATGGCCACCACTGCTGCCTGAAATGCTTTGACAAGTTCTGTGCCAACACCTGTGTGGAATGCCGCAAGCCCATCGGTGCGGACTCCAAGGAGGTGCACTATAAGAACCGCTTCTGGCATGACACCTGCTTCCGCTGTGCCAAGTGCCTTCACCCCTTGGCCAATGAGACCTTTGTGGCCAAGGACAACAAGATCCTGTGCAACAAGTGCACCACTCGGGAGGACTCCCCCAAGTGCAAGGGGTGCTTCAAGGCCATTGTGGCAGGAGATCAAAACGTGGAGTACAAGGGGACCGTCTGGCACAAAGACTGCTTCACCTGTAGTAACTGCAAGCAAGTCATCGGGACTGGAAGCTTCTTCCCTAAAGGGGAGGACTTCTACTGCGTGACTTGCCATGAGACCAAGTTTGCCAAGCATTGCGTGAAGTGCAACAAGGCCATCACATCTGGAGGAATCACTTACCAGGATCAGCCCTGGCATGCCGATTGCTTTGTGTGTGTTACCTGCTCTAAGAAGCTGGCTGGGCAGCGTTTCACCGCTGTGGAGGACCAGTATTACTGCGTGGATTGCTACAAGAACTTTGTGGCCAAGAAGTGTGCTGGATGCAAGAACCCCATCACTGGGTTTGGTAAAGGCTCCAGTGTGGTGGCCTATGAAGGACAATCCTGGCACGACTACTGCTTCCACTGCAAAAAATGCTCCGTGAATCTGGCCAACAAGCGCTTTGTTTTCCACCAGGAGCAAGTGTATTGTCCCGACTGTGCCAAAAAGCTGTAA |
| ORF Protein Sequence | MAEKFDCHYCRDPLQGKKYVQKDGHHCCLKCFDKFCANTCVECRKPIGADSKEVHYKNRFWHDTCFRCAKCLHPLANETFVAKDNKILCNKCTTREDSPKCKGCFKAIVAGDQNVEYKGTVWHKDCFTCSNCKQVIGTGSFFPKGEDFYCVTCHETKFAKHCVKCNKAITSGGITYQDQPWHADCFVCVTCSKKLAGQRFTAVEDQYYCVDCYKNFVAKKCAGCKNPITGFGKGSSVVAYEGQSWHDYCFHCKKCSVNLANKRFVFHQEQVYCPDCAKKL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T81135-Ab | Anti-FHL1/ FCMSU/ FHL-1A monoclonal antibody |
| Target Antigen | GM-Tg-g-T81135-Ag | FHL1 VLP (virus-like particle) |
| ORF Viral Vector | pGMAD001494 | Human FHL1 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000161 | Human FHL1 Adenovirus plasmid |
| ORF Viral Vector | vGMAD001494 | Human FHL1 Adenovirus particle |
| ORF Viral Vector | vGMAP000161 | Human FHL1 Adenovirus particle |
Target information
| Target ID | GM-T81135 |
| Target Name | FHL1 |
| Gene ID | 2273, 14199, 710692, 25177, 101098207, 492162, 509056, 100056943 |
| Gene Symbol and Synonyms | FCMSU,FHL-1,FHL1,FHL1A,FHL1B,FLH1A,KYOT,RAM14-1,RBMX1A,RBMX1B,SLIM,SLIM-1,SLIM1,SLIMMER,XMPMA |
| Uniprot Accession | Q13642 |
| Uniprot Entry Name | FHL1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Prostate Cancer |
| Gene Ensembl | ENSG00000022267 |
| Target Classification | Not Available |
This gene encodes a member of the four-and-a-half-LIM-only protein family. Family members contain two highly conserved, tandemly arranged, zinc finger domains with four highly conserved cysteines binding a zinc atom in each zinc finger. Expression of these family members occurs in a cell- and tissue-specific mode and these proteins are involved in many cellular processes. Mutations in this gene have been found in patients with Emery-Dreifuss muscular dystrophy. Multiple alternately spliced transcript variants which encode different protein isoforms have been described.[provided by RefSeq, Nov 2009]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


