Human FGF18/FGF-18/ ZFGF5 ORF/cDNA clone-Adenovirus particle (BC006245)
Pre-made Human FGF18/FGF-18/ ZFGF5 Adenovirus for FGF18 overexpression in-vitro and in-vivo. The FGF18 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified FGF18-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to FGF18/FGF-18 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000362 | Human FGF18 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000362 |
Gene Name | FGF18 |
Accession Number | BC006245 |
Gene ID | 8817 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 624 bp |
Gene Alias | FGF-18, ZFGF5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTATTCAGCGCCCTCCGCCTGCACTTGCCTGTGTTTACACTTCCTGCTGCTGTGCTTCCAGGTACAGGTGCTGGTTGCCGAGGAGAACGTGGACTTCCGCATCCACGTGGAGAACCAGACGCGGGCTCGGGACGATGTGAGCCGTAAGCAGCTGCGGCTGTACCAGCTCTACAGCCGGACCAGTGGGAAACACATCCAGGTCCTGGGCCGCAGGATCAGTGCCCGCGGCGAGGATGGGGACAAGTATGCCCAGCTCCTAGTGGAGACAGACACCTTCGGTAGTCAAGTCCGGATCAAGGGCAAGGAGACGGAATTCTACCTGTGCATGAACCGCAAAGGCAAGCTCGTGGGGAAGCCCGATGGCACCAGCAAGGAGTGTGTGTTCATCGAGAAGGTTCTGGAGAACAACTACACGGCCCTGATGTCGGCTAAGTACTCCGGCTGGTACGTGGGCTTCACCAAGAAGGGGCGGCCGCGGAAGGGCCCCAAGACCCGGGAGAACCAGCAGGACGTGCATTTCATGAAGCGCTACCCCAAGGGGCAGCCGGAGCTTCAGAAGCCCTTCAAGTACACGACGGTGACCAAGAGGTCCCGTCGGATCCGGCCCACACACCCTGCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T99732-Ab | Anti-FGF18/ FGF-18/ ZFGF5 functional antibody |
Target Antigen | GM-Tg-g-T99732-Ag | FGF18 protein |
Cytokine | cks-Tg-g-GM-T99732 | fibroblast growth factor 18 (FGF18) protein & antibody |
ORF Viral Vector | pGMLP000468 | Human FGF18 Lentivirus plasmid |
ORF Viral Vector | pGMAP000362 | Human FGF18 Adenovirus plasmid |
ORF Viral Vector | vGMLP000468 | Human FGF18 Lentivirus particle |
ORF Viral Vector | vGMAP000362 | Human FGF18 Adenovirus particle |
Target information
Target ID | GM-T99732 |
Target Name | FGF18 |
Gene ID | 8817, 14172, 702072, 29369, 101098518, 611641, 533929, 100629648 |
Gene Symbol and Synonyms | D130055P09Rik,FGF-18,FGF18,Fgf6a,ZFGF5 |
Uniprot Accession | O76093 |
Uniprot Entry Name | FGF18_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000156427 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that this protein is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Knockout studies of the similar gene in mice implied the role of this protein in regulating proliferation and differentiation of midline cerebellar structures. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.