Human FGF18/FGF-18/ ZFGF5 ORF/cDNA clone-Adenovirus particle (BC006245)

Pre-made Human FGF18/FGF-18/ ZFGF5 Adenovirus for FGF18 overexpression in-vitro and in-vivo. The FGF18 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified FGF18-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to FGF18/FGF-18 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000362 Human FGF18 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000362
Gene Name FGF18
Accession Number BC006245
Gene ID 8817
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 624 bp
Gene Alias FGF-18, ZFGF5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTATTCAGCGCCCTCCGCCTGCACTTGCCTGTGTTTACACTTCCTGCTGCTGTGCTTCCAGGTACAGGTGCTGGTTGCCGAGGAGAACGTGGACTTCCGCATCCACGTGGAGAACCAGACGCGGGCTCGGGACGATGTGAGCCGTAAGCAGCTGCGGCTGTACCAGCTCTACAGCCGGACCAGTGGGAAACACATCCAGGTCCTGGGCCGCAGGATCAGTGCCCGCGGCGAGGATGGGGACAAGTATGCCCAGCTCCTAGTGGAGACAGACACCTTCGGTAGTCAAGTCCGGATCAAGGGCAAGGAGACGGAATTCTACCTGTGCATGAACCGCAAAGGCAAGCTCGTGGGGAAGCCCGATGGCACCAGCAAGGAGTGTGTGTTCATCGAGAAGGTTCTGGAGAACAACTACACGGCCCTGATGTCGGCTAAGTACTCCGGCTGGTACGTGGGCTTCACCAAGAAGGGGCGGCCGCGGAAGGGCCCCAAGACCCGGGAGAACCAGCAGGACGTGCATTTCATGAAGCGCTACCCCAAGGGGCAGCCGGAGCTTCAGAAGCCCTTCAAGTACACGACGGTGACCAAGAGGTCCCGTCGGATCCGGCCCACACACCCTGCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T99732-Ab Anti-FGF18/ FGF-18/ ZFGF5 functional antibody
    Target Antigen GM-Tg-g-T99732-Ag FGF18 protein
    Cytokine cks-Tg-g-GM-T99732 fibroblast growth factor 18 (FGF18) protein & antibody
    ORF Viral Vector pGMLP000468 Human FGF18 Lentivirus plasmid
    ORF Viral Vector pGMAP000362 Human FGF18 Adenovirus plasmid
    ORF Viral Vector vGMLP000468 Human FGF18 Lentivirus particle
    ORF Viral Vector vGMAP000362 Human FGF18 Adenovirus particle


    Target information

    Target ID GM-T99732
    Target Name FGF18
    Gene ID 8817, 14172, 702072, 29369, 101098518, 611641, 533929, 100629648
    Gene Symbol and Synonyms D130055P09Rik,FGF-18,FGF18,Fgf6a,ZFGF5
    Uniprot Accession O76093
    Uniprot Entry Name FGF18_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000156427
    Target Classification Not Available

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that this protein is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Knockout studies of the similar gene in mice implied the role of this protein in regulating proliferation and differentiation of midline cerebellar structures. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.