Human PSEN2/AD3L/AD4 ORF/cDNA clone-Adenovirus particle (BC006365)

Cat. No.: vGMAP000396

Pre-made Human PSEN2/AD3L/AD4 Adenovirus for PSEN2 overexpression in-vitro and in-vivo. The PSEN2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PSEN2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to PSEN2/AD3L products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000396 Human PSEN2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000396
Gene Name PSEN2
Accession Number BC006365
Gene ID 5664
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1347 bp
Gene Alias AD3L,AD4,PS2,STM2
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCACATTCATGGCCTCTGACAGCGAGGAAGAAGTGTGTGATGAGCGGACGTCCCTAATGTCGGCCGAGAGCCCCACGCCGCGCTCCTGCCAGGAGGGCAGGCAGGGCCCAGAGGATGGAGAGAATACTGCCCAGTGGAGAAGCCAGGAGAACGAGGAGGACGGTGAGGAGGACCCTGACCGCTATGTCTGTAGTGGGGTTCCCGGGCGGCCGCCAGGCCTGGAGGAAGAGCTGACCCTCAAATACGGAGCGAAGCATGTGATCATGCTGTTTGTGCCTGTCACTCTGTGCATGATCGTGGTGGTAGCCACCATCAAGTCTGTGCGCTTCTACACAGAGAAGAATGGACAGCTCATCTACACGCCATTCACTGAGGACACACCCTCGGTGGGCCAGCGCCTCCTCAACTCCGTGCTGAACACCCTCATCATGATCAGCGTCATCGTGGTTATGACCATCTTCTTGGTGGTGCTCTACAAGTACCGCTGCTACAAGTTCATCCATGGCTGGTTGATCATGTCTTCACTGATGCTGCTGTTCCTCTTCACCTATATCTACCTTGGGGAAGTGCTCAAGACCTACAATGTGGCCATGGACTACCCCACCCTCTTGCTGACTGTCTGGAACTTCGGGGCAGTGGGCATGGTGTGCATCCACTGGAAGGGCCCTCTGGTGCTGCAGCAGGCCTACCTCATCATGATCAGTGCGCTCATGGCCCTAGTGTTCATCAAGTACCTCCCAGAGTGGTCCGCGTGGGTCATCCTGGGCGCCATCTCTGTGTATGATCTCGTGGCTGTGCTGTGTCCCAAAGGGCCTCTGAGAATGCTGGTAGAAACTGCCCAGGAGAGAAATGAGCCCATATTCCCTGCCCTGATATACTCATCTGCCATGGTGTGGACGGTTGGCATGGCGAAGCTGGACCCCTCCTCTCAGGGTGCCCTCCAGCTCCCCTACGACCCGGAGATGGAAGAAGACTCCTATGACAGTTTTGGGGAGCCTTCATACCCCGAAGTCTTTGAGCCTCCCTTGACTGGCTACCCAGGGGAGGAGCTGGAGGAAGAGGAGGAAAGGGGCGTGAAGCTTGGCCTCGGGGACTTCATCTTCTACAGTGTGCTGGTGGGCAAGGCGGCTGCCACGGGCAGCGGGGACTGGAATACCACGCTGGCCTGCTTCGTGGCCATCCTCATTGGCTTGTGTCTGACCCTCCTGCTGCTTGCTGTGTTCAAGAAGGCGCTGCCCGCCCTCCCCATCTCCATCACGTTCGGGCTCATCTTTTACTTCTCCACGGACAACCTGGTGCGGCCGTTCATGGACACCCTGGCCTCCCATCAGCTCTACATCTGA
ORF Protein Sequence MLTFMASDSEEEVCDERTSLMSAESPTPRSCQEGRQGPEDGENTAQWRSQENEEDGEEDPDRYVCSGVPGRPPGLEEELTLKYGAKHVIMLFVPVTLCMIVVVATIKSVRFYTEKNGQLIYTPFTEDTPSVGQRLLNSVLNTLIMISVIVVMTIFLVVLYKYRCYKFIHGWLIMSSLMLLFLFTYIYLGEVLKTYNVAMDYPTLLLTVWNFGAVGMVCIHWKGPLVLQQAYLIMISALMALVFIKYLPEWSAWVILGAISVYDLVAVLCPKGPLRMLVETAQERNEPIFPALIYSSAMVWTVGMAKLDPSSQGALQLPYDPEMEEDSYDSFGEPSYPEVFEPPLTGYPGEELEEEEERGVKLGLGDFIFYSVLVGKAAATGSGDWNTTLACFVAILIGLCLTLLLLAVFKKALPALPISITFGLIFYFSTDNLVRPFMDTLASHQLYI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T99204-Ab Anti-PSN2/ PSEN2/ AD3L monoclonal antibody
    Target Antigen GM-Tg-g-T99204-Ag PSEN2 VLP (virus-like particle)
    ORF Viral Vector pGMAP000396 Human PSEN2 Adenovirus plasmid
    ORF Viral Vector vGMAP000396 Human PSEN2 Adenovirus particle


    Target information

    Target ID GM-T99204
    Target Name PSEN2
    Gene ID 5664, 19165, 698770, 81751, 101081693, 490382, 282010, 100054506
    Gene Symbol and Synonyms AD3L,AD4,Ad4h,ALG-3,Alg3,CMD1V,PS-2,PS2,PSEN2,Psnl2,STM2
    Uniprot Accession P49810
    Uniprot Entry Name PSN2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000143801
    Target Classification Tumor-associated antigen (TAA)

    Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1 or PSEN2) or the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor such that, they either directly regulate gamma-secretase activity, or themselves act are protease enzymes. Two alternatively spliced transcript variants encoding different isoforms of PSEN2 have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.