Human CCR1/CD191/CKR-1 ORF/cDNA clone-Adenovirus particle (BC051306)
Cat. No.: vGMAP000400
Pre-made Human CCR1/CD191/CKR-1 Adenovirus for CCR1 overexpression in-vitro and in-vivo. The CCR1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CCR1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
CCR1/CD191 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000400 | Human CCR1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000400 |
| Gene Name | CCR1 |
| Accession Number | BC051306 |
| Gene ID | 1230 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1068 bp |
| Gene Alias | CD191,CKR-1,HM145,MIP1aR |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAAACTCCAAACACCACAGAGGACTATGACACGACCACAGAGTTTGACTATGGGGATGCAACTCCGTGCCAGAAGGTGAACGAGAGGGCCTTTGGGGCCCAACTGCTGCCCCCTCTGTACTCCTTGGTATTTGTCATTGGCCTGGTTGGAAACATCCTGGTGGTCCTGGTCCTTGTGCAATACAAGAGGCTAAAAAACATGACCAGCATCTACCTCCTGAACCTGGCCATTTCTGACCTGCTCTTCCTGTTCACGCTTCCCTTCTGGATCGACTACAAGTTGAAGGATGACTGGGTTTTTGGTGATGCCATGTGTAAGATCCTCTCTGGGTTTTATTACACAGGCTTGTACAGCGAGATCTTTTTCATCATCCTGCTGACGATTGACAGGTACCTGGCCATCGTCCACGCCGTGTTTGCCTTGCGGGCACGGACCGTCACTTTTGGTGTCATCACCAGCATCATCATTTGGGCCCTGGCCATCTTGGCTTCCATGCCAGGCTTATACTTTTCCAAGACCCAATGGGAATTCACTCACCACACCTGCAGCCTTCACTTTCCTCACGAAAGCCTACGAGAGTGGAAGCTGTTTCAGGCTCTGAAACTGAACCTCTTTGGGCTGGTATTGCCTTTGTTGGTCATGATCATCTGCTACACAGGGATTATAAAGATTCTGCTAAGACGACCAAATGAGAAGAAATCCAAAGCTGTCCGTTTGATTTTTGTCATCATGATCATCTTTTTTCTCTTTTGGACCCCCTACAATTTGACTATACTTATTTCTGTTTTCCAAGACTTCCTGTTCACCCATGAGTGTGAGCAGAGCAGACATTTGGACCTGGCTGTGCAAGTGACGGAGGTGATCGCCTACACGCACTGCTGTGTCAACCCAGTGATCTACGCCTTCGTTGGTGAGAGGTTCCGGAAGTACCTGCGGCAGTTGTTCCACAGGCGTGTGGCTGTGCACCTGGTTAAATGGCTCCCCTTCCTCTCCGTGGACAGGCTGGAGAGGGTCAGCTCCACATCTCCCTCCACAGGGGAGCATGAACTCTCTGCTGGGTTCTGA |
| ORF Protein Sequence | METPNTTEDYDTTTEFDYGDATPCQKVNERAFGAQLLPPLYSLVFVIGLVGNILVVLVLVQYKRLKNMTSIYLLNLAISDLLFLFTLPFWIDYKLKDDWVFGDAMCKILSGFYYTGLYSEIFFIILLTIDRYLAIVHAVFALRARTVTFGVITSIIIWALAILASMPGLYFSKTQWEFTHHTCSLHFPHESLREWKLFQALKLNLFGLVLPLLVMIICYTGIIKILLRRPNEKKSKAVRLIFVIMIIFFLFWTPYNLTILISVFQDFLFTHECEQSRHLDLAVQVTEVIAYTHCCVNPVIYAFVGERFRKYLRQLFHRRVAVHLVKWLPFLSVDRLERVSSTSPSTGEHELSAGF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T16016-Ab | Anti-CCR1/ CD191/ CKR-1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T16016-Ag | CCR1 VLP (virus-like particle) |
| Cytokine | cks-Tg-g-GM-T16016 | chemokine (C-C motif) receptor 1 (CCR1) protein & antibody |
| ORF Viral Vector | pGMLP000541 | Human CCR1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000400 | Human CCR1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000541 | Human CCR1 Lentivirus particle |
| ORF Viral Vector | vGMAP000400 | Human CCR1 Adenovirus particle |
Target information
| Target ID | GM-T16016 |
| Target Name | CCR1 |
| Gene ID | 1230, 12768, 574188, 57301, 100191004, 484791, 407771, 100065466 |
| Gene Symbol and Synonyms | CCR1,CD191,CKR-1,CKR1,CMKBR1,HM145,Mip-1a-R,MIP1aR,SCYAR1 |
| Uniprot Accession | P32246 |
| Uniprot Entry Name | CCR1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000163823 |
| Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


