Human CCL11/MGC22554 ORF/cDNA clone-Adenovirus particle (BC017850)

Pre-made Human CCL11/MGC22554 Adenovirus for CCL11 overexpression in-vitro and in-vivo. The CCL11 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CCL11-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to CCL11/MGC22554 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000414 Human CCL11 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000414
Gene Name CCL11
Accession Number BC017850
Gene ID 6356
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 294 bp
Gene Alias MGC22554
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGGTCTCCGCAGCACTTCTGTGGCTGCTGCTCATAGCAGCTGCCTTCAGCCCCCAGGGGCTCGCTGGGCCAGCTTCTGTCCCAACCACCTGCTGCTTTAACCTGGCCAATAGGAAGATACCCCTTCAGCGACTAGAGAGCTACAGGAGAATCACCAGTGGCAAATGTCCCCAGAAAGCTGTGATCTTCAAGACCAAACTGGCCAAGGATATCTGTGCCGACCCCAAGAAGAAGTGGGTGCAGGATTCCATGAAGTATCTGGACCAAAAATCTCCAACTCCAAAGCCATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-755 Pre-Made Bertilimumab Biosimilar, Whole Mab, Anti-Ccl11 Antibody: Anti-SCYA11 therapeutic antibody
    Target Antibody GM-Tg-g-T16888-Ab Anti-CCL11/ SCYA11 functional antibody
    Target Antigen GM-Tg-g-T16888-Ag CCL11 protein
    Cytokine cks-Tg-g-GM-T16888 chemokine (C-C motif) ligand 11 (CCL11) protein & antibody
    ORF Viral Vector pGMLP000540 Human CCL11 Lentivirus plasmid
    ORF Viral Vector pGMAP000414 Human CCL11 Adenovirus plasmid
    ORF Viral Vector vGMLP000540 Human CCL11 Lentivirus particle
    ORF Viral Vector vGMAP000414 Human CCL11 Adenovirus particle


    Target information

    Target ID GM-T16888
    Target Name CCL11
    Gene ID 6356, 574218
    Gene Symbol and Synonyms CCL11,Eotaxin,SCYA11
    Uniprot Accession P51671
    Uniprot Entry Name CCL11_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000172156
    Target Classification Not Available

    This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity for eosinophils, but not mononuclear cells or neutrophils. This eosinophil-specific chemokine is thought to be involved in eosinophilic inflammatory diseases such as atopic dermatitis, allergic rhinitis, asthma and parasitic infections. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.