Human CCL11/SCYA11 ORF/cDNA clone-Lentivirus particle (NM_002986)

Pre-made Human CCL11/SCYA11 Lentiviral expression plasmid for CCL11 lentivirus packaging, CCL11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCL11/SCYA11 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000540 Human CCL11 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000540
Gene Name CCL11
Accession Number NM_002986
Gene ID 6356
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 294 bp
Gene Alias SCYA11
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGGTCTCCGCAGCACTTCTGTGGCTGCTGCTCATAGCAGCTGCCTTCAGCCCCCAGGGGCTCGCTGGGCCAGCTTCTGTCCCAACCACCTGCTGCTTTAACCTGGCCAATAGGAAGATACCCCTTCAGCGACTAGAGAGCTACAGGAGAATCACCAGTGGCAAATGTCCCCAGAAAGCTGTGATCTTCAAGACCAAACTGGCCAAGGATATCTGTGCCGACCCCAAGAAGAAGTGGGTGCAGGATTCCATGAAGTATCTGGACCAAAAATCTCCAACTCCAAAGCCATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-755 Pre-Made Bertilimumab Biosimilar, Whole Mab, Anti-Ccl11 Antibody: Anti-SCYA11 therapeutic antibody
    Target Antibody GM-Tg-g-T16888-Ab Anti-CCL11/ SCYA11 functional antibody
    Target Antigen GM-Tg-g-T16888-Ag CCL11 protein
    Cytokine cks-Tg-g-GM-T16888 chemokine (C-C motif) ligand 11 (CCL11) protein & antibody
    ORF Viral Vector pGMLP000540 Human CCL11 Lentivirus plasmid
    ORF Viral Vector pGMAP000414 Human CCL11 Adenovirus plasmid
    ORF Viral Vector vGMLP000540 Human CCL11 Lentivirus particle
    ORF Viral Vector vGMAP000414 Human CCL11 Adenovirus particle


    Target information

    Target ID GM-T16888
    Target Name CCL11
    Gene ID 6356, 574218
    Gene Symbol and Synonyms CCL11,Eotaxin,SCYA11
    Uniprot Accession P51671
    Uniprot Entry Name CCL11_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000172156
    Target Classification Not Available

    This antimicrobial gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity for eosinophils, but not mononuclear cells or neutrophils. This eosinophil-specific chemokine is thought to be involved in eosinophilic inflammatory diseases such as atopic dermatitis, allergic rhinitis, asthma and parasitic infections. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.