Human TYR/OCA1A/ OCAIA ORF/cDNA clone-Adenovirus particle (BC027179)

Pre-made Human TYR/OCA1A/ OCAIA Adenovirus for TYR overexpression in-vitro and in-vivo. The TYR adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TYR-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to TYR/OCA1A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000437 Human TYR Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000437
Gene Name TYR
Accession Number BC027179
Gene ID 7299
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1134 bp
Gene Alias OCA1A, OCAIA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTCCTGGCTGTTTTGTACTGCCTGCTGTGGAGTTTCCAGACCTCCGCTGGCCATTTCCCTAGAGCCTGTGTCTCCTCTAAGAACCTGATGGAGAAGGAATGCTGTCCACCGTGGAGCGGGGACAGGAGTCCCTGTGGCCAGCTTTCAGGCAGAGGTTCCTGTCAGAATATCCTTCTGTCCAATGCACCACTTGGGCCTCAATTTCCCTTCACAGGGGTGGATGACCGGGAGTCGTGGCCTTCCGTCTTTTATAATAGGACCTGCCAGTGCTCTGGCAACTTCATGGGATTCAACTGTGGAAACTGCAAGTTTGGCTTTTGGGGACCAAACTGCACAGAGAGACGACTCTTGGTGAGAAGAAACATCTTCGATTTGAGTGCCCCAGAGAAGGACAAATTTTTTGCCTACCTCACTTTAGCAAAGCATACCATCAGCTCAGACTATGTCATCCCCATAGGGACCTATGGCCAAATGAAAAATGGATCAACACCCATGTTTAACGACATCAATATTTATGACCTCTTTGTCTGGATGCATTATTATGTGTCAATGGATGCACTGCTTGGGGGATCTGAAATCTGGAGAGACATTGATTTTGCCCATGAAGCACCAGCTTTTCTGCCTTGGCATAGACTCTTCTTGTTGCGGTGGGAACAAGAAATCCAGAAGCTGACAGGAGATGAAAACTTCACTATTCCATATTGGGACTGGCGGGATGCAGAAAAGTGTGACATTTGCACAGATGAGTACATGGGAGGTCAGCACCCCACAAATCCTAACTTACTCAGCCCAGCATCATTCTTCTCCTCTTGGCAGATTGTCTGTAGCCGATTGGAGGAGTACAACAGCCATCAGTCTTTATGCAATGGAACGCCCGAGGGACCTTTACGGCGTAATCCTGGAAACCATGACAAATCCAGAACCCCAAGGCTCCCCTCTTCAGCTGATGTAGAATTTTGCCTGAGTTTGACCCAATATGAATCTGGTTCCATGGATAAAGCTGCCAATTTCAGCTTTAGAAATACACTGGAAGAGATGGGATTTCTCCATGTTGGCTGGGCTGGTCTCAAACTCCTGACCTCAAGAGATCCACCACCTTGGCCTCCCAAAATGCTGGGATTACAGGCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0016-Ab Anti-TYR monoclonal antibody
    Target Antigen GM-Tg-g-IP0016-Ag TYR protein
    ORF Viral Vector pGMAP000129 Human TYR Adenovirus plasmid
    ORF Viral Vector pGMAP000437 Human TYR Adenovirus plasmid
    ORF Viral Vector vGMAP000129 Human TYR Adenovirus particle
    ORF Viral Vector vGMAP000437 Human TYR Adenovirus particle


    Target information

    Target ID GM-IP0016
    Target Name TYR
    Gene ID 7299, 22173, 705792, 308800, 751100, 403405, 280951, 100060227
    Gene Symbol and Synonyms albino,ATN,c,CMM8,OCA1,OCA1A,OCAIA,SHEP3,skc35,TYR
    Uniprot Accession P14679
    Uniprot Entry Name TYRO_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000077498
    Target Classification Checkpoint-Immuno Oncology

    The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.