Human CEACAM3/CD66D/ CEA ORF/cDNA clone-Adenovirus particle (BC106728)

Pre-made Human CEACAM3/CD66D/ CEA Adenovirus for CEACAM3 overexpression in-vitro and in-vivo. The CEACAM3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CEACAM3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to CD66d/CEACAM3/CD66D products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000486 Human CEACAM3 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000486
Gene Name CEACAM3
Accession Number BC106728
Gene ID 1084
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 759 bp
Gene Alias CD66D, CEA, W264, W282
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGCCCCCCTCAGCCTCTCCCCACAGAGAATGCATCCCCTGGCAGGGGCTTCTGCTCACAGCCTCACTTCTAAACTTCTGGAACCCGCCCACCACTGCCAAGCTCACTATTGAATCCATGCCGCTCAGTGTCGCAGAGGGGAAGGAGGTGCTTCTACTTGTCCACAATCTGCCCCAGCATCTTTTTGGCTACAGCTGGTACAAAGGGGAAAGAGTGGATGGCAACAGTCTAATTGTAGGATATGTAATAGGAACTCAACAAGCTACCCCAGGGGCCGCATACAGCGGTCGAGAGACAATATACACCAATGCATCCCTGCTGATCCAGAATGTCACCCAGAATGACATAGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACTGGACAGTTCCATGTATACCAAGAAAATGCCCCAGGCCTTCCTGTGGGGGCCGTCGCCGGCATCGTGACCGGGGTCCTGGTCGGAGTGGCGCTGGTGGCCGCGCTGGTGTGTTTCCTGCTCCTTGCCAAAACTGGAAGAACCAGCATCCAGCGTGACCTCAAGGAGCAGCAGCCCCAAGCCCTTGCCCCTGGCCGTGGTCCCTCCCACAGCTCTGCCTTCTCGATGTCCCCTCTCTCCACTGCCCAGGCCCCCCTACCCAACCCCAGGACAGCAGCTTCCATCTATGAGGAATTGCTAAAACATGACACAAACATTTACTGCCGGATGGACCACAAAGCAGAAGTGGCTTCTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T21890-Ab Anti-CEAM3/ CD66d/ CEACAM3 monoclonal antibody
    Target Antigen GM-Tg-g-T21890-Ag CD66d/CEACAM3 VLP (virus-like particle)
    ORF Viral Vector pGMAP000486 Human CEACAM3 Adenovirus plasmid
    ORF Viral Vector vGMAP000486 Human CEACAM3 Adenovirus particle


    Target information

    Target ID GM-T21890
    Target Name CD66d
    Gene ID 1084, 707824
    Gene Symbol and Synonyms CD66D,CEA,CEACAM3,CGM1,W264,W282
    Uniprot Accession P40198
    Uniprot Entry Name CEAM3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000170956
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes a member of the family of carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), which are used by several bacterial pathogens to bind and invade host cells. The encoded transmembrane protein directs phagocytosis of several bacterial species that is dependent on the small GTPase Rac. It is thought to serve an important role in controlling human-specific pathogens by the innate immune system. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.