Human CEACAM3/CD66D/ CEA ORF/cDNA clone-Adenovirus particle (BC106728)
Pre-made Human CEACAM3/CD66D/ CEA Adenovirus for CEACAM3 overexpression in-vitro and in-vivo. The CEACAM3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CEACAM3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CD66d/CEACAM3/CD66D products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000486 | Human CEACAM3 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000486 |
Gene Name | CEACAM3 |
Accession Number | BC106728 |
Gene ID | 1084 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 759 bp |
Gene Alias | CD66D, CEA, W264, W282 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGCCCCCCTCAGCCTCTCCCCACAGAGAATGCATCCCCTGGCAGGGGCTTCTGCTCACAGCCTCACTTCTAAACTTCTGGAACCCGCCCACCACTGCCAAGCTCACTATTGAATCCATGCCGCTCAGTGTCGCAGAGGGGAAGGAGGTGCTTCTACTTGTCCACAATCTGCCCCAGCATCTTTTTGGCTACAGCTGGTACAAAGGGGAAAGAGTGGATGGCAACAGTCTAATTGTAGGATATGTAATAGGAACTCAACAAGCTACCCCAGGGGCCGCATACAGCGGTCGAGAGACAATATACACCAATGCATCCCTGCTGATCCAGAATGTCACCCAGAATGACATAGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACTGGACAGTTCCATGTATACCAAGAAAATGCCCCAGGCCTTCCTGTGGGGGCCGTCGCCGGCATCGTGACCGGGGTCCTGGTCGGAGTGGCGCTGGTGGCCGCGCTGGTGTGTTTCCTGCTCCTTGCCAAAACTGGAAGAACCAGCATCCAGCGTGACCTCAAGGAGCAGCAGCCCCAAGCCCTTGCCCCTGGCCGTGGTCCCTCCCACAGCTCTGCCTTCTCGATGTCCCCTCTCTCCACTGCCCAGGCCCCCCTACCCAACCCCAGGACAGCAGCTTCCATCTATGAGGAATTGCTAAAACATGACACAAACATTTACTGCCGGATGGACCACAAAGCAGAAGTGGCTTCTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T21890-Ab | Anti-CEAM3/ CD66d/ CEACAM3 monoclonal antibody |
Target Antigen | GM-Tg-g-T21890-Ag | CD66d/CEACAM3 VLP (virus-like particle) |
ORF Viral Vector | pGMAP000486 | Human CEACAM3 Adenovirus plasmid |
ORF Viral Vector | vGMAP000486 | Human CEACAM3 Adenovirus particle |
Target information
Target ID | GM-T21890 |
Target Name | CD66d |
Gene ID | 1084, 707824 |
Gene Symbol and Synonyms | CD66D,CEA,CEACAM3,CGM1,W264,W282 |
Uniprot Accession | P40198 |
Uniprot Entry Name | CEAM3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target |
Disease | Cancer |
Gene Ensembl | ENSG00000170956 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
This gene encodes a member of the family of carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), which are used by several bacterial pathogens to bind and invade host cells. The encoded transmembrane protein directs phagocytosis of several bacterial species that is dependent on the small GTPase Rac. It is thought to serve an important role in controlling human-specific pathogens by the innate immune system. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.