Human CHGA/CGA ORF/cDNA clone-Adenovirus particle (BC001059)

Pre-made Human CHGA/CGA Adenovirus for CHGA overexpression in-vitro and in-vivo. The CHGA adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CHGA-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to CHGA/CGA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000499 Human CHGA Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000499
Gene Name CHGA
Accession Number BC001059
Gene ID 1113
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1374 bp
Gene Alias CGA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGCTCCGCCGCTGTCCTGGCTCTTCTGCTCTGCGCCGGGCAAGTCACTGCGCTCCCTGTGAACAGCCCTATGAATAAAGGGGATACCGAGGTGATGAAATGCATCGTTGAGGTCATCTCCGACACACTTTCCAAGCCCAGCCCCATGCCTGTCAGCCAGGAATGTTTTGAGACACTCCGAGGAGATGAACGGATCCTTTCCATTCTGAGACATCAGAATTTACTGAAGGAGCTCCAAGACCTCGCTCTCCAAGGCGCCAAGGAGAGGGCACATCAGCAGAAGAAACACAGCGGTTTTGAAGATGAACTCTCAGAGGTTCTTGAGAACCAGAGCAGCCAGGCCGAGCTGAAAGAGGCGGTGGAAGAGCCATCATCCAAGGATGTTATGGAGAAAAGAGAGGATTCCAAGGAGGCAGAGAAAAGTGGTGAAGCCACAGACGGAGCCAGGCCCCAGGCCCTCCCGGAGCCCATGCAGGAGTCCAAGGCTGAGGGGAACAATCAGGCCCCTGGGGAGGAAGAGGAGGAGGAGGAGGAGGCCACCAACACCCACCCTCCAGCCAGCCTCCCCAGCCAGAAATACCCAGGCCCACAGGCCGAGGGGGACAGTGAGGGCCTCTCTCAGGGTCTGGTGGACAGAGAGAAGGGCCTGAGTGCAGAGCCAGGGTGGCAGGCAAAGAGAGAAGAGGAGGAGGAGGAGGAGGAGGAGGCTGAGGCTGGAGAGGAGGCTGTCCCCGAGGAAGAAGGCCCCACTGTAGTGCTGAACCCCCACCCGAGCCTTGGCTACAAGGAGATCCGGAAAGGCGAGAGTCGGTCGGAGGCTCTGGCTGTGGATGGAGCTGGGAAGCCTGGGGCTGAGGAGGCTCAGGACCCCGAAGGGAAGGGAGAACAGGAGCACTCCCAGCAGAAAGAGGAGGAGGAGGAGATGGCAGTGGTCCCGCAAGGCCTCTTCCGGGGTGGGAAGAGCGGAGAGCTGGAGCAGGAGGAGGAGCGGCTCTCCAAGGAGTGGGAGGACTCCAAACGCTGGAGCAAGATGGACCAGCTGGCCAAGGAGCTGACGGCTGAGAAGCGGCTGGAGGGGCAGGAGGAGGAGGAGGACAACCGGGACAGTTCCATGAAGCTCTCCTTCCGGGCCCGGGCCTACGGCTTCAGGGGCCCTGGGCCGCAGCTGCGACGAGGCTGGAGGCCATCCTCCCGGGAGGACAGCCTTGAGGCGGGCCTGCCCCTCCAGGTCCGAGGCTACCCCGAGGAGAAGAAAGAGGAGGAGGGCAGCGCAAACCGCAGACCAGAGGACCAGGAGCTGGAGAGCCTGTCGGCCATTGAGGCAGAGCTGGAGAAAGTGGCCCACCAGCTGCAGGCACTACGGCGGGGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0080-Ab Anti-CMGA/ CHGA/ CGA functional antibody
    Target Antigen GM-Tg-g-SE0080-Ag CHGA protein
    ORF Viral Vector pGMAP000499 Human CHGA Adenovirus plasmid
    ORF Viral Vector vGMAP000499 Human CHGA Adenovirus particle


    Target information

    Target ID GM-SE0080
    Target Name CHGA
    Gene ID 1113, 12652, 574388, 24258, 101087412, 607527, 281070, 111770391
    Gene Symbol and Synonyms CGA,CHGA,ChrA,PHE5,PHES
    Uniprot Accession P10645
    Uniprot Entry Name CMGA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Breast Cancer, neuroen docrine
    Gene Ensembl ENSG00000100604
    Target Classification Not Available

    The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. It is found in secretory vesicles of neurons and endocrine cells. This gene product is a precursor to three biologically active peptides; vasostatin, pancreastatin, and parastatin. These peptides act as autocrine or paracrine negative modulators of the neuroendocrine system. Two other peptides, catestatin and chromofungin, have antimicrobial activity and antifungal activity, respectively. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.