Human JUN/AP1/ c-Jun ORF/cDNA clone-Adenovirus particle (BC006175)
Pre-made Human JUN/AP1/ c-Jun Adenovirus for JUN overexpression in-vitro and in-vivo. The JUN adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified JUN-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to JUN/AP1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000535 | Human JUN Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000535 |
Gene Name | JUN |
Accession Number | BC006175 |
Gene ID | 3725 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 996 bp |
Gene Alias | AP1, c-Jun |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T69085-Ab | Anti-JUN monoclonal antibody |
Target Antigen | GM-Tg-g-T69085-Ag | JUN protein |
ORF Viral Vector | pGMLV000295 | Human JUN Lentivirus plasmid |
ORF Viral Vector | pGMLV001213 | Rat Jun Lentivirus plasmid |
ORF Viral Vector | pGMLV001471 | Human JUN Lentivirus plasmid |
ORF Viral Vector | pGMAD000140 | Human JUN Adenovirus plasmid |
ORF Viral Vector | pGMAD000912 | Human JUN Adenovirus plasmid |
ORF Viral Vector | pGMAAV000691 | Rat Jun Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000142 | Human JUN Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000535 | Human JUN Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-129 | Human JUN Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-269 | Human JUN Adenovirus plasmid |
ORF Viral Vector | vGMLV000295 | Human JUN Lentivirus particle |
ORF Viral Vector | vGMLV001213 | Rat Jun Lentivirus particle |
ORF Viral Vector | vGMLV001471 | Human JUN Lentivirus particle |
ORF Viral Vector | vGMAD000140 | Human JUN Adenovirus particle |
ORF Viral Vector | vGMAD000912 | Human JUN Adenovirus particle |
ORF Viral Vector | vGMAAV000691 | Rat Jun Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000535 | Human JUN Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-129 | Human JUN Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-269 | Human JUN Adenovirus particle |
Target information
Target ID | GM-T69085 |
Target Name | JUN |
Gene ID | 3725, 16476, 716452, 24516, 101097261, 609429, 280831, 100067469 |
Gene Symbol and Synonyms | AP-1,AP1,c-Jun,cJUN,JUN,Junc,p39 |
Uniprot Accession | P05412 |
Uniprot Entry Name | JUN_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000177606 |
Target Classification | Tumor-associated antigen (TAA) |
This gene is the putative transforming gene of avian sarcoma virus 17. It encodes a protein which is highly similar to the viral protein, and which interacts directly with specific target DNA sequences to regulate gene expression. This gene is intronless and is mapped to 1p32-p31, a chromosomal region involved in both translocations and deletions in human malignancies. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.