Human PLK1/STPK13 ORF/cDNA clone-Adenovirus particle (BC002369)

Pre-made Human PLK1/STPK13 Adenovirus for PLK1 overexpression in-vitro and in-vivo. The PLK1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PLK1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to PLK1/STPK13 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000536 Human PLK1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000536
Gene Name PLK1
Accession Number BC002369
Gene ID 5347
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1812 bp
Gene Alias STPK13
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGTGCTGCAGTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCCGGGGTCCCCGGAGTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATCCCGGAGGTCCTAGTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGCAAGGGCGGCTTTGCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCGGGCAAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATGGAAATATCCATTCACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTCGAGGACAACGACTTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAGCTGCACAAGAGGAGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATTGTGCTTGGCTGCCAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCTTAATGACGAGTTCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACCATTCCACCAAGGTTTTCGATTGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTCACAGTCCTCAATAAAGGCTTGGAGAACCCCCTGCCTGAGCGTCCCCGGGAAAAAGAAGAACCAGTGGTTCGAGAGACAGGTGAGGTGGTCGACTGCCACCTCAGTGACATGCTGCAGCAGCTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGGTCAGGCAAGAGGAGGCTGAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAGTACGGCCTTGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACACGCCTCATCCTCTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAGTCCTACCTCACCGTGAGTTCCCATCCCAACTCCTTGATGAAGAAGATCACCCTCCTTAAATATTTCCGCAATTACATGAGCGAGCACTTGCTGAAGGCAGGTGCCAACATCACGCCGCGCGAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCTGGTTCCGCACCCGCAGCGCCATCATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGATCACACCAAGCTCATCTTGTGCCCACTGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGCACATACCGCCTGAGTCTCCTGGAGGAGTACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTCCGCTACGCCCGCACTATGGTGGACAAGCTGCTGAGCTCACGCTCGGCCAGCAACCGTCTCAAGGCCTCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T40694-Ab Anti-PLK1 monoclonal antibody
    Target Antigen GM-Tg-g-T40694-Ag PLK1 protein
    ORF Viral Vector pGMLV001066 Human PLK1 Lentivirus plasmid
    ORF Viral Vector pGMLV001461 Human PLK1 Lentivirus plasmid
    ORF Viral Vector pGMAD000864 Rat Plk1 Adenovirus plasmid
    ORF Viral Vector pGMAAV000609 Rat Plk1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000536 Human PLK1 Adenovirus plasmid
    ORF Viral Vector vGMLV001066 Human PLK1 Lentivirus particle
    ORF Viral Vector vGMLV001461 Human PLK1 Lentivirus particle
    ORF Viral Vector vGMAD000864 Rat Plk1 Adenovirus particle
    ORF Viral Vector vGMAAV000609 Rat Plk1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000536 Human PLK1 Adenovirus particle


    Target information

    Target ID GM-T40694
    Target Name PLK1
    Gene ID 5347, 18817, 697686, 25515, 101098508, 489971, 538238, 100068388
    Gene Symbol and Synonyms PLK,PLK1,STPK13
    Uniprot Accession P53350
    Uniprot Entry Name PLK1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000166851
    Target Classification Kinase, Tumor-associated antigen (TAA)

    The Ser/Thr protein kinase encoded by this gene belongs to the CDC5/Polo subfamily. It is highly expressed during mitosis and elevated levels are found in many different types of cancer. Depletion of this protein in cancer cells dramatically inhibited cell proliferation and induced apoptosis; hence, it is a target for cancer therapy. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.