Human CXCL8/3-10C/ AMCF-I ORF/cDNA clone-Adenovirus particle (BC013615)

Pre-made Human CXCL8/3-10C/ AMCF-I Adenovirus for CXCL8 overexpression in-vitro and in-vivo. The CXCL8 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CXCL8-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to IL8/CXCL8/3-10C products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000556 Human CXCL8 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000556
Gene Name CXCL8
Accession Number BC013615
Gene ID 3576
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 300 bp
Gene Alias 3-10C, AMCF-I, b-ENAP, CXCL8, GCP-1, GCP1, IL-8, K60, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP-1, NAP1, SCYB8, TSG-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGTGAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATACTCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACACTGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T22658-Ab Anti-IL8/ CXCL8/ GCP-1 functional antibody
    Target Antigen GM-Tg-g-T22658-Ag IL8/CXCL8 protein
    Cytokine cks-Tg-g-GM-T22658 interleukin 8 (IL8) protein & antibody
    ORF Viral Vector pGMLV000447 Human CXCL8 Lentivirus plasmid
    ORF Viral Vector pGMLV000943 Human CXCL8 Lentivirus plasmid
    ORF Viral Vector pGMLV001490 Human CXCL8 Lentivirus plasmid
    ORF Viral Vector pGMAD000710 Human CXCL8 Adenovirus plasmid
    ORF Viral Vector pGMAP000556 Human CXCL8 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-011 Human CXCL8 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-094 Human CXCL8 Adenovirus plasmid
    ORF Viral Vector vGMLV000447 Human CXCL8 Lentivirus particle
    ORF Viral Vector vGMLV000943 Human CXCL8 Lentivirus particle
    ORF Viral Vector vGMLV001490 Human CXCL8 Lentivirus particle
    ORF Viral Vector vGMAD000710 Human CXCL8 Adenovirus particle
    ORF Viral Vector vGMAP000556 Human CXCL8 Adenovirus particle
    ORF Viral Vector vGMLP-IL-011 Human CXCL8 Lentivirus particle
    ORF Viral Vector vGMAP-IL-094 Human CXCL8 Adenovirus particle


    Target information

    Target ID GM-T22658
    Target Name IL8
    Gene ID 3576, 613028, 403850, 280828, 100037400
    Gene Symbol and Synonyms CXCL8,GCP-1,GCP1,IL-8,IL8,LECT,LUCT,LYNAP,MDNCF,MONAP,NAF,NAP-1,NAP1,SCYB8
    Uniprot Accession P10145
    Uniprot Entry Name IL8_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000169429
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a member of the CXC chemokine family and is a major mediator of the inflammatory response. The encoded protein is commonly referred to as interleukin-8 (IL-8). IL-8 is secreted by mononuclear macrophages, neutrophils, eosinophils, T lymphocytes, epithelial cells, and fibroblasts. It functions as a chemotactic factor by guiding the neutrophils to the site of infection. Bacterial and viral products rapidly induce IL-8 expression. IL-8 also participates with other cytokines in the proinflammatory signaling cascade and plays a role in systemic inflammatory response syndrome (SIRS). This gene is believed to play a role in the pathogenesis of the lower respiratory tract infection bronchiolitis, a common respiratory tract disease caused by the respiratory syncytial virus (RSV). The overproduction of this proinflammatory protein is thought to cause the lung inflammation associated with csytic fibrosis. This proinflammatory protein is also suspected of playing a role in coronary artery disease and endothelial dysfunction. This protein is also secreted by tumor cells and promotes tumor migration, invasion, angiogenesis and metastasis. This chemokine is also a potent angiogenic factor. The binding of IL-8 to one of its receptors (IL-8RB/CXCR2) increases the permeability of blood vessels and increasing levels of IL-8 are positively correlated with increased severity of multiple disease outcomes (eg, sepsis). This gene and other members of the CXC chemokine gene family form a gene cluster in a region of chromosome 4q. [provided by RefSeq, May 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.