Human IL8/3-10C/AMCF-I ORF/cDNA clone-Adenovirus plasmid (BC013615)
Cat. No.: pGMAP000556
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IL8/3-10C/AMCF-I adenoviral expression plasmid for IL8 adenovirus packaging, IL8 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
IL8/3-10C products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000556 |
| Gene Name | IL8 |
| Accession Number | BC013615 |
| Gene ID | 3576 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 300 bp |
| Gene Alias | 3-10C,AMCF-I,b-ENAP,CXCL8,GCP-1,GCP1,IL-8,K60,LECT,LUCT,LYNAP,MDNCF,MONAP,NAF,NAP-1,NAP1,SCYB8,TSG-1 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGTGAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATACTCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACACTGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA |
| ORF Protein Sequence | MTSKLAVALLAAFLISAALCEGAVLPRSAKELRCQCIKTYSKPFHPKFIKELRVIESGPHCANTEIIVKLSDGRELCLDPKENWVQRVVEKFLKRAENS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T22658-Ab | Anti-IL8/ CXCL8/ GCP-1 functional antibody |
| Target Antigen | GM-Tg-g-T22658-Ag | IL8/CXCL8 protein |
| Cytokine | cks-Tg-g-GM-T22658 | interleukin 8 (IL8) protein & antibody |
| ORF Viral Vector | pGMLV000447 | Human CXCL8 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000943 | Human CXCL8 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001490 | Human CXCL8 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000710 | Human CXCL8 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000556 | Human IL8 Adenovirus plasmid |
| ORF Viral Vector | pGMLP-IL-011 | Human CXCL8 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-IL-094 | Human CXCL8 Adenovirus plasmid |
| ORF Viral Vector | vGMLV000447 | Human CXCL8 Lentivirus particle |
| ORF Viral Vector | vGMLV000943 | Human CXCL8 Lentivirus particle |
| ORF Viral Vector | vGMLV001490 | Human CXCL8 Lentivirus particle |
| ORF Viral Vector | vGMAD000710 | Human CXCL8 Adenovirus particle |
| ORF Viral Vector | vGMAP000556 | Human IL8 Adenovirus particle |
| ORF Viral Vector | vGMLP-IL-011 | Human CXCL8 Lentivirus particle |
| ORF Viral Vector | vGMAP-IL-094 | Human CXCL8 Adenovirus particle |
Target information
| Target ID | GM-T22658 |
| Target Name | IL8 |
| Gene ID | 3576, 613028, 403850, 280828, 100037400 |
| Gene Symbol and Synonyms | CXCL8,GCP-1,GCP1,IL-8,IL8,LECT,LUCT,LYNAP,MDNCF,MONAP,NAF,NAP-1,NAP1,SCYB8 |
| Uniprot Accession | P10145 |
| Uniprot Entry Name | IL8_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000169429 |
| Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene is a member of the CXC chemokine family and is a major mediator of the inflammatory response. The encoded protein is commonly referred to as interleukin-8 (IL-8). IL-8 is secreted by mononuclear macrophages, neutrophils, eosinophils, T lymphocytes, epithelial cells, and fibroblasts. It functions as a chemotactic factor by guiding the neutrophils to the site of infection. Bacterial and viral products rapidly induce IL-8 expression. IL-8 also participates with other cytokines in the proinflammatory signaling cascade and plays a role in systemic inflammatory response syndrome (SIRS). This gene is believed to play a role in the pathogenesis of the lower respiratory tract infection bronchiolitis, a common respiratory tract disease caused by the respiratory syncytial virus (RSV). The overproduction of this proinflammatory protein is thought to cause the lung inflammation associated with csytic fibrosis. This proinflammatory protein is also suspected of playing a role in coronary artery disease and endothelial dysfunction. This protein is also secreted by tumor cells and promotes tumor migration, invasion, angiogenesis and metastasis. This chemokine is also a potent angiogenic factor. The binding of IL-8 to one of its receptors (IL-8RB/CXCR2) increases the permeability of blood vessels and increasing levels of IL-8 are positively correlated with increased severity of multiple disease outcomes (eg, sepsis). This gene and other members of the CXC chemokine gene family form a gene cluster in a region of chromosome 4q. [provided by RefSeq, May 2020]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


