Human CXCL8/3-10C/ AMCF-I ORF/cDNA clone-Adenovirus plasmid (BC013615)

Product information

Catalog No.	Product Name	Plasmid Grade	Plasmid quantity
pGMAP000556	Human CXCL8 Adenovirus plasmid	Research Grade	10mg, 50mg, 100mg, 500mg, >1g
		GMP-like Grade	10mg, 50mg, 100mg, 500mg, >1g
		High Quality (HQ) Grade
		Seed	5ug

Product Description

Catalog ID	pGMAP000556
Gene Name	CXCL8
Accession Number	BC013615
Gene ID	3576
Species	Human
Product Type	Adenovirus plasmid (overexpression)
Insert Length	300 bp
Gene Alias	3-10C, AMCF-I, b-ENAP, CXCL8, GCP-1, GCP1, IL-8, K60, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP-1, NAP1, SCYB8, TSG-1
Fluorescent Reporter	ZsGreen
Mammalian Cell Selection	Puromyocin
Fusion Tag	3xflag (C-Terminal)
Promoter	CMV
Resistance	Amplicin
Sequence	ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGTGAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATACTCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACACTGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA

Reference

Data / case study

Click to get more Data / Case study about the product.

Associated products

Category	Cat No.	Products Name
Target Antibody	GM-Tg-g-T22658-Ab	Anti-IL8/ CXCL8/ GCP-1 functional antibody
Target Antigen	GM-Tg-g-T22658-Ag	IL8/CXCL8 protein
Cytokine	cks-Tg-g-GM-T22658	interleukin 8 (IL8) protein & antibody
ORF Viral Vector	pGMLV000447	Human CXCL8 Lentivirus plasmid
ORF Viral Vector	pGMLV000943	Human CXCL8 Lentivirus plasmid
ORF Viral Vector	pGMLV001490	Human CXCL8 Lentivirus plasmid
ORF Viral Vector	pGMAD000710	Human CXCL8 Adenovirus plasmid
ORF Viral Vector	pGMAP000556	Human CXCL8 Adenovirus plasmid
ORF Viral Vector	pGMLP-IL-011	Human CXCL8 Lentivirus plasmid
ORF Viral Vector	pGMAP-IL-094	Human CXCL8 Adenovirus plasmid
ORF Viral Vector	vGMLV000447	Human CXCL8 Lentivirus particle
ORF Viral Vector	vGMLV000943	Human CXCL8 Lentivirus particle
ORF Viral Vector	vGMLV001490	Human CXCL8 Lentivirus particle
ORF Viral Vector	vGMAD000710	Human CXCL8 Adenovirus particle
ORF Viral Vector	vGMAP000556	Human CXCL8 Adenovirus particle
ORF Viral Vector	vGMLP-IL-011	Human CXCL8 Lentivirus particle
ORF Viral Vector	vGMAP-IL-094	Human CXCL8 Adenovirus particle

Target information

Target ID	GM-T22658
Target Name	IL8
Gene ID	3576, 613028, 403850, 280828, 100037400
Gene Symbol and Synonyms	CXCL8,GCP-1,GCP1,IL-8,IL8,LECT,LUCT,LYNAP,MDNCF,MONAP,NAF,NAP-1,NAP1,SCYB8
Uniprot Accession	P10145
Uniprot Entry Name	IL8_HUMAN
Protein Sub-location	Secreted Protein/Potential Cytokines
Category	Therapeutics Target, Immuno-oncology Target, Cytokine Target
Disease	Not Available
Gene Ensembl	ENSG00000169429
Target Classification	Checkpoint-Immuno Oncology

The protein encoded by this gene is a member of the CXC chemokine family and is a major mediator of the inflammatory response. The encoded protein is commonly referred to as interleukin-8 (IL-8). IL-8 is secreted by mononuclear macrophages, neutrophils, eosinophils, T lymphocytes, epithelial cells, and fibroblasts. It functions as a chemotactic factor by guiding the neutrophils to the site of infection. Bacterial and viral products rapidly induce IL-8 expression. IL-8 also participates with other cytokines in the proinflammatory signaling cascade and plays a role in systemic inflammatory response syndrome (SIRS). This gene is believed to play a role in the pathogenesis of the lower respiratory tract infection bronchiolitis, a common respiratory tract disease caused by the respiratory syncytial virus (RSV). The overproduction of this proinflammatory protein is thought to cause the lung inflammation associated with csytic fibrosis. This proinflammatory protein is also suspected of playing a role in coronary artery disease and endothelial dysfunction. This protein is also secreted by tumor cells and promotes tumor migration, invasion, angiogenesis and metastasis. This chemokine is also a potent angiogenic factor. The binding of IL-8 to one of its receptors (IL-8RB/CXCR2) increases the permeability of blood vessels and increasing levels of IL-8 are positively correlated with increased severity of multiple disease outcomes (eg, sepsis). This gene and other members of the CXC chemokine gene family form a gene cluster in a region of chromosome 4q. [provided by RefSeq, May 2020]

About GMVC