Human GPRC5A/RAIG1 ORF/cDNA clone-Adenovirus particle (BC003665)
Pre-made Human GPRC5A/RAIG1 Adenovirus for GPRC5A overexpression in-vitro and in-vivo. The GPRC5A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GPRC5A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to GPRC5A/RAIG1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000559 | Human GPRC5A Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000559 |
Gene Name | GPRC5A |
Accession Number | BC003665 |
Gene ID | 9052 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1074 bp |
Gene Alias | RAIG1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTACAACAGTCCCTGATGGTTGCCGCAATGGCCTGAAATCCAAGTACTACAGACTTTGTGATAAGGCTGAAGCTTGGGGCATCGTCCTAGAAACGGTGGCCACAGCTGGGGTTGTGACCTCGGTGGCCTTCATGCTCACTCTCCCGATCCTCGTCTGCAAGGTGCAGGACTCCAACAGGCGAAAAATGCTGCCTACTCAGTTTCTCTTCCTCCTGGGTGTGTTGGGCATCTTTGGCCTCACCTTCGCCTTCATCATCGGACTGGACGGGAGCACAGGGCCCACACGCTTCTTCCTCTTTGGGATCCTCTTTTCCATCTGCTTCTCCTGCCTGCTGGCTCATGCTGTCAGTCTGACCAAGCTCGTCCGGGGGAGGAAGCCCCTTTCCCTGTTGGTGATTCTGGGTCTGGCCGTGGGCTTCAGCCTAGTCCAGGATGTTATCGCTATTGAATATATTGTCCTGACCATGAATAGGACCAACGTCAATGTCTTTTCTGAGCTTTCCGCTCCTCGTCGCAATGAAGACTTTGTCCTCCTGCTCACCTACGTCCTCTTCTTGATGGCGCTGACCTTCCTCATGTCCTCCTTCACCTTCTGTGGTTCCTTCACGGGCTGGAAGAGACATGGGGCCCACATCTACCTCACGATGCTCCTCTCCATTGCCATCTGGGTGGCCTGGATCACCCTGCTCATGCTTCCTGACTTTGACCGCAGGTGGGATGACACCATCCTCAGCTCCGCCTTGGCTGCCAATGGCTGGGTGTTCCTGTTGGCTTATGTTAGTCCCGAGTTTTGGCTGCTCACAAAGCAACGAAACCCCATGGATTATCCTGTTGAGGATGCTTTCTGTAAACCTCAACTCGTGAAGAAGAGCTATGGTGTGGAGAACAGAGCCTACTCTCAAGAGGAAATCACTCAAGGTTTTGAAGAGACAGGGGACACGCTCTATGCCCCCTATTCCACACATTTTCAGCTGCAGAACCAGCCTCCCCAAAAGGAATTCTCCATCCCACGGGCCCACGCTTGGCCGAGCCCTTACAAAGACTATGAAGTAAAGAAAGAGGGCAGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0551-Ab | Anti-RAI3/ GPRC5A/ GPCR5A monoclonal antibody |
Target Antigen | GM-Tg-g-MP0551-Ag | GPRC5A VLP (virus-like particle) |
ORF Viral Vector | pGMLV000250 | Human GPRC5A Lentivirus plasmid |
ORF Viral Vector | pGMAP000559 | Human GPRC5A Adenovirus plasmid |
ORF Viral Vector | vGMLV000250 | Human GPRC5A Lentivirus particle |
ORF Viral Vector | vGMAP000559 | Human GPRC5A Adenovirus particle |
Target information
Target ID | GM-MP0551 |
Target Name | GPRC5A |
Gene ID | 9052, 232431, 697555, 312790, 101093366, 486680, 516026, 100063606 |
Gene Symbol and Synonyms | GPCR5A,GPRC5A,PEIG-1,RAI3,RAIG1,TIG1 |
Uniprot Accession | Q8NFJ5 |
Uniprot Entry Name | RAI3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000013588 |
Target Classification | GPCR |
This gene encodes a member of the type 3 G protein-coupling receptor family, characterized by the signature 7-transmembrane domain motif. The encoded protein may be involved in interaction between retinoid acid and G protein signalling pathways. Retinoic acid plays a critical role in development, cellular growth, and differentiation. This gene may play a role in embryonic development and epithelial cell differentiation. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.