Human RCN1/PIG20/ RCAL ORF/cDNA clone-Adenovirus particle (BC010120)

Pre-made Human RCN1/PIG20/ RCAL Adenovirus for RCN1 overexpression in-vitro and in-vivo. The RCN1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified RCN1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to RCN1/PIG20 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000573 Human RCN1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000573
Gene Name RCN1
Accession Number BC010120
Gene ID 5954
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 996 bp
Gene Alias PIG20, RCAL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGCGCGGTGGCCGCGGCCGCCGCCTGGGGTTAGCCCTGGGGCTGCTGCTGGCGCTGGTGCTGGCGCCGCGGGTTCTGCGGGCCAAGCCCACGGTGCGCAAAGAGCGCGTGGTGCGGCCCGACTCGGAGCTGGGCGAGCGGCCCCCTGAGGACAACCAGAGCTTCCAGTACGACCACGAGGCCTTCCTGGGCAAGGAGGACTCCAAGACCTTCGACCAGCTCACCCCGGACGAGAGCAAGGAGAGGCTAGGGAAGATTGTTGATCGAATCGACAATGATGGGGATGGCTTTGTCACTACTGAGGAGCTGAAAACCTGGATCAAACGGGTGCAGAAAAGATACATCTTTGATAATGTCGCCAAAGTCTGGAAGGATTATGATAGGGACAAGGATGATAAAATTTCCTGGGAAGAATACAAACAAGCCACCTATGGTTACTACCTAGGAAACCCCGCAGAGTTTCATGATTCTTCAGATCATCACACCTTTAAAAAGATGCTGCCACGTGATGAGAGAAGATTCAAAGCTGCAGACCTCAATGGTGACCTGACAGCTACTCGGGAGGAGTTCACTGCCTTTCTGCATCCTGAAGAGTTTGAACATATGAAGGAAATTGTGGTTTTGGAAACCCTGGAGGACATCGACAAGAACGGGGATGGGTTTGTGGATCAGGATGAGTATATTGCGGATATGTTTTCCCATGAGGAGAATGGCCCTGAGCCAGACTGGGTTTTATCAGAACGGGAGCAGTTTAACGAATTCCGGGATCTGAACAAGGACGGGAAGTTAGACAAAGATGAGATTCGCCACTGGATCCTCCCTCAAGATTATGATCATGCACAGGCTGAGGCCAGGCATCTGGTATATGAATCAGACAAAAACAAGGATGAGAAGCTAACTAAAGAGGAAATATTGGAGAACTGGAACATGTTTGTCGGAAGCCAAGCTACCAATTACGGGGAAGATCTCACAAAAAATCATGATGAGCTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0442-Ab Anti-RCN1/ HEL-S-84/ PIG20 functional antibody
    Target Antigen GM-Tg-g-SE0442-Ag RCN1 protein
    ORF Viral Vector pGMLV000272 Human RCN1 Lentivirus plasmid
    ORF Viral Vector pGMAP000573 Human RCN1 Adenovirus plasmid
    ORF Viral Vector vGMLV000272 Human RCN1 Lentivirus particle
    ORF Viral Vector vGMAP000573 Human RCN1 Adenovirus particle


    Target information

    Target ID GM-SE0442
    Target Name RCN1
    Gene ID 5954, 19672, 696800, 362182, 101088272, 475952, 281445, 100072670
    Gene Symbol and Synonyms HEL-S-84,PIG20,RCAL,RCN,RCN1
    Uniprot Accession Q15293
    Uniprot Entry Name RCN1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000049449
    Target Classification Not Available

    Reticulocalbin 1 is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. High conservation of amino acid residues outside of these motifs, in comparison to mouse reticulocalbin, is consistent with a possible biochemical function besides that of calcium binding. In human endothelial and prostate cancer cell lines this protein localizes to the plasma membrane.[provided by RefSeq, Jan 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.