Human RCN1/PIG20/ RCAL ORF/cDNA clone-Adenovirus particle (BC010120)
Pre-made Human RCN1/PIG20/ RCAL Adenovirus for RCN1 overexpression in-vitro and in-vivo. The RCN1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified RCN1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to RCN1/PIG20 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000573 | Human RCN1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000573 |
Gene Name | RCN1 |
Accession Number | BC010120 |
Gene ID | 5954 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 996 bp |
Gene Alias | PIG20, RCAL |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGCGCGGTGGCCGCGGCCGCCGCCTGGGGTTAGCCCTGGGGCTGCTGCTGGCGCTGGTGCTGGCGCCGCGGGTTCTGCGGGCCAAGCCCACGGTGCGCAAAGAGCGCGTGGTGCGGCCCGACTCGGAGCTGGGCGAGCGGCCCCCTGAGGACAACCAGAGCTTCCAGTACGACCACGAGGCCTTCCTGGGCAAGGAGGACTCCAAGACCTTCGACCAGCTCACCCCGGACGAGAGCAAGGAGAGGCTAGGGAAGATTGTTGATCGAATCGACAATGATGGGGATGGCTTTGTCACTACTGAGGAGCTGAAAACCTGGATCAAACGGGTGCAGAAAAGATACATCTTTGATAATGTCGCCAAAGTCTGGAAGGATTATGATAGGGACAAGGATGATAAAATTTCCTGGGAAGAATACAAACAAGCCACCTATGGTTACTACCTAGGAAACCCCGCAGAGTTTCATGATTCTTCAGATCATCACACCTTTAAAAAGATGCTGCCACGTGATGAGAGAAGATTCAAAGCTGCAGACCTCAATGGTGACCTGACAGCTACTCGGGAGGAGTTCACTGCCTTTCTGCATCCTGAAGAGTTTGAACATATGAAGGAAATTGTGGTTTTGGAAACCCTGGAGGACATCGACAAGAACGGGGATGGGTTTGTGGATCAGGATGAGTATATTGCGGATATGTTTTCCCATGAGGAGAATGGCCCTGAGCCAGACTGGGTTTTATCAGAACGGGAGCAGTTTAACGAATTCCGGGATCTGAACAAGGACGGGAAGTTAGACAAAGATGAGATTCGCCACTGGATCCTCCCTCAAGATTATGATCATGCACAGGCTGAGGCCAGGCATCTGGTATATGAATCAGACAAAAACAAGGATGAGAAGCTAACTAAAGAGGAAATATTGGAGAACTGGAACATGTTTGTCGGAAGCCAAGCTACCAATTACGGGGAAGATCTCACAAAAAATCATGATGAGCTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0442-Ab | Anti-RCN1/ HEL-S-84/ PIG20 functional antibody |
Target Antigen | GM-Tg-g-SE0442-Ag | RCN1 protein |
ORF Viral Vector | pGMLV000272 | Human RCN1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000573 | Human RCN1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000272 | Human RCN1 Lentivirus particle |
ORF Viral Vector | vGMAP000573 | Human RCN1 Adenovirus particle |
Target information
Target ID | GM-SE0442 |
Target Name | RCN1 |
Gene ID | 5954, 19672, 696800, 362182, 101088272, 475952, 281445, 100072670 |
Gene Symbol and Synonyms | HEL-S-84,PIG20,RCAL,RCN,RCN1 |
Uniprot Accession | Q15293 |
Uniprot Entry Name | RCN1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000049449 |
Target Classification | Not Available |
Reticulocalbin 1 is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. High conservation of amino acid residues outside of these motifs, in comparison to mouse reticulocalbin, is consistent with a possible biochemical function besides that of calcium binding. In human endothelial and prostate cancer cell lines this protein localizes to the plasma membrane.[provided by RefSeq, Jan 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.