Human ATG5/APG5/APG5-LIKE ORF/cDNA clone-Lentivirus particle (NM_004849.3)
Cat. No.: vGMLP-atg-001
Pre-made Human ATG5/APG5/APG5-LIKE Lentiviral expression plasmid for ATG5 lentivirus packaging, ATG5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ATG5/APG5 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP-atg-001 | Human ATG5 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP-atg-001 |
| Gene Name | ATG5 |
| Accession Number | NM_004849.3 |
| Gene ID | 9474 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 828 bp |
| Gene Alias | APG5,APG5-LIKE,APG5L,ASP,hAPG5,SCAR25 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGACAGATGACAAAGATGTGCTTCGAGATGTGTGGTTTGGACGAATTCCAACTTGTTTCACGCTATATCAGGATGAGATAACTGAAAGGGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTAAGTTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGACATTAGTGAGATATGGTTTGAATATGAAGGCACACCACTGAAATGGCATTATCCAATTGGTTTGCTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTTAAGAGTTTTCCAGAAAAAGACCTTCTGCACTGTCCATCTAAGGATGCAATTGAAGCTCATTTTATGTCATGTATGAAAGAAGCTGATGCTTTAAAACATAAAAGTCAAGTAATCAATGAAATGCAGAAAAAAGATCACAAGCAACTCTGGATGGGATTGCAAAATGACAGATTTGACCAGTTTTGGGCCATCAATCGGAAACTCATGGAATATCCTGCAGAAGAAAATGGATTTCGTTATATCCCCTTTAGAATATATCAGACAACGACTGAAAGACCTTTCATTCAGAAGCTGTTTCGTCCTGTGGCTGCAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGA |
| ORF Protein Sequence | MTDDKDVLRDVWFGRIPTCFTLYQDEITEREAEPYYLLLPRVSYLTLVTDKVKKHFQKVMRQEDISEIWFEYEGTPLKWHYPIGLLFDLLASSSALPWNITVHFKSFPEKDLLHCPSKDAIEAHFMSCMKEADALKHKSQVINEMQKKDHKQLWMGLQNDRFDQFWAINRKLMEYPAEENGFRYIPFRIYQTTTERPFIQKLFRPVAADGQLHTLGDLLKEVCPSAIDPEDGEKKNQVMIHGIEPMLETPLQWLSEHLSYPDNFLHISIIPQPTD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1410-Ab | Anti-ATG5/ APG5/ APG5-LIKE functional antibody |
| Target Antigen | GM-Tg-g-SE1410-Ag | ATG5 protein |
| ORF Viral Vector | pGMLV000230 | Human ATG5 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000506 | Human ATG5 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000816 | Human ATG5 Adenovirus plasmid |
| ORF Viral Vector | pGMLP-atg-001 | Human ATG5 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-atg-055 | Human ATG5 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000798 | Human ATG5 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001411 | Human ATG5 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV000230 | Human ATG5 Lentivirus particle |
| ORF Viral Vector | vGMLV000506 | Human ATG5 Lentivirus particle |
| ORF Viral Vector | vGMAD000816 | Human ATG5 Adenovirus particle |
| ORF Viral Vector | vGMLP-atg-001 | Human ATG5 Lentivirus particle |
| ORF Viral Vector | vGMAP-atg-055 | Human ATG5 Adenovirus particle |
Target information
| Target ID | GM-SE1410 |
| Target Name | ATG5 |
| Gene ID | 9474, 11793, 696874, 365601, 101092114, 610868, 532686, 100066344 |
| Gene Symbol and Synonyms | 2010107M05Rik,3110067M24Rik,APG5,APG5-LIKE,APG5L,ASP,ATG5,Atg5l,hAPG5,Paddy,SCAR25 |
| Uniprot Accession | Q9H1Y0 |
| Uniprot Entry Name | ATG5_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Cancer |
| Gene Ensembl | ENSG00000057663 |
| Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Several transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


