Human ATG5/APG5/APG5-LIKE ORF/cDNA clone-Lentivirus particle (NM_004849.3)

Cat. No.: vGMLP-atg-001

Pre-made Human ATG5/APG5/APG5-LIKE Lentiviral expression plasmid for ATG5 lentivirus packaging, ATG5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ATG5/APG5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP-atg-001 Human ATG5 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP-atg-001
Gene Name ATG5
Accession Number NM_004849.3
Gene ID 9474
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 828 bp
Gene Alias APG5,APG5-LIKE,APG5L,ASP,hAPG5,SCAR25
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACAGATGACAAAGATGTGCTTCGAGATGTGTGGTTTGGACGAATTCCAACTTGTTTCACGCTATATCAGGATGAGATAACTGAAAGGGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTAAGTTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGACATTAGTGAGATATGGTTTGAATATGAAGGCACACCACTGAAATGGCATTATCCAATTGGTTTGCTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTTAAGAGTTTTCCAGAAAAAGACCTTCTGCACTGTCCATCTAAGGATGCAATTGAAGCTCATTTTATGTCATGTATGAAAGAAGCTGATGCTTTAAAACATAAAAGTCAAGTAATCAATGAAATGCAGAAAAAAGATCACAAGCAACTCTGGATGGGATTGCAAAATGACAGATTTGACCAGTTTTGGGCCATCAATCGGAAACTCATGGAATATCCTGCAGAAGAAAATGGATTTCGTTATATCCCCTTTAGAATATATCAGACAACGACTGAAAGACCTTTCATTCAGAAGCTGTTTCGTCCTGTGGCTGCAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGCTATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAGCCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATAATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGA
ORF Protein Sequence MTDDKDVLRDVWFGRIPTCFTLYQDEITEREAEPYYLLLPRVSYLTLVTDKVKKHFQKVMRQEDISEIWFEYEGTPLKWHYPIGLLFDLLASSSALPWNITVHFKSFPEKDLLHCPSKDAIEAHFMSCMKEADALKHKSQVINEMQKKDHKQLWMGLQNDRFDQFWAINRKLMEYPAEENGFRYIPFRIYQTTTERPFIQKLFRPVAADGQLHTLGDLLKEVCPSAIDPEDGEKKNQVMIHGIEPMLETPLQWLSEHLSYPDNFLHISIIPQPTD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1410-Ab Anti-ATG5/ APG5/ APG5-LIKE functional antibody
    Target Antigen GM-Tg-g-SE1410-Ag ATG5 protein
    ORF Viral Vector pGMLV000230 Human ATG5 Lentivirus plasmid
    ORF Viral Vector pGMLV000506 Human ATG5 Lentivirus plasmid
    ORF Viral Vector pGMAD000816 Human ATG5 Adenovirus plasmid
    ORF Viral Vector pGMLP-atg-001 Human ATG5 Lentivirus plasmid
    ORF Viral Vector pGMAP-atg-055 Human ATG5 Adenovirus plasmid
    ORF Viral Vector pGMPC000798 Human ATG5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001411 Human ATG5 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000230 Human ATG5 Lentivirus particle
    ORF Viral Vector vGMLV000506 Human ATG5 Lentivirus particle
    ORF Viral Vector vGMAD000816 Human ATG5 Adenovirus particle
    ORF Viral Vector vGMLP-atg-001 Human ATG5 Lentivirus particle
    ORF Viral Vector vGMAP-atg-055 Human ATG5 Adenovirus particle


    Target information

    Target ID GM-SE1410
    Target Name ATG5
    Gene ID 9474, 11793, 696874, 365601, 101092114, 610868, 532686, 100066344
    Gene Symbol and Synonyms 2010107M05Rik,3110067M24Rik,APG5,APG5-LIKE,APG5L,ASP,ATG5,Atg5l,hAPG5,Paddy,SCAR25
    Uniprot Accession Q9H1Y0
    Uniprot Entry Name ATG5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000057663
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Several transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.