Human HYAL1/HYAL-1/LUCA1 ORF/cDNA clone-Lentivirus particle (NM_033159)

Cat. No.: vGMLP000113

Pre-made Human HYAL1/HYAL-1/LUCA1 Lentiviral expression plasmid for HYAL1 lentivirus packaging, HYAL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to HYAL1/HYAL-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000113 Human HYAL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000113
Gene Name HYAL1
Accession Number NM_033159
Gene ID 3373
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1308 bp
Gene Alias HYAL-1,LUCA1,MPS9,NAT6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGCCCACCTGCTTCCCATCTGCGCCCTCTTCCTGACCTTACTCGATATGGCCCAAGGCTTTAGGGGCCCCTTGCTACCCAACCGGCCCTTCACCACCGTCTGGAATGCAAACACCCAGTGGTGCCTGGAGAGGCACGGTGTGGACGTGGATGTCAGTGTCTTCGATGTGGTAGCCAACCCAGGGCAGACCTTCCGCGGCCCTGACATGACAATTTTCTATAGCTCCCAGCTGGGCACCTACCCCTACTACACGCCCACTGGGGAGCCTGTGTTTGGTGGTCTGCCCCAGAATGCCAGCCTGATTGCCCACCTGGCCCGCACATTCCAGGACATCCTGGCTGCCATACCTGCTCCTGACTTCTCAGGGCTGGCAGTCATCGACTGGGAGGCATGGCGCCCACGCTGGGCCTTCAACTGGGACACCAAGGACATTTACCGGCAGCGCTCACGGGCACTGGTACAGGCACAGCACCCTGATTGGCCAGCTCCTCAGGTGGAGGCAGTAGCCCAGGACCAGTTCCAGGGAGCTGCACGGGCCTGGATGGCAGGCACCCTCCAGCTGGGGCGGGCACTGCGTCCTCGCGGCCTCTGGGGCTTCTATGGCTTCCCTGACTGCTACAACTATGACTTTCTAAGCCCCAACTACACCGGCCAGTGCCCATCAGGCATCCGTGCCCAAAATGACCAGCTAGGGTGGCTGTGGGGCCAGAGCCGTGCCCTCTATCCCAGCATCTACATGCCCGCAGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCAACACCGTGTGGCCGAGGCATTCCGTGTGGCTGTGGCTGCTGGTGACCCCAATCTGCCGGTGCTGCCCTATGTCCAGATCTTCTATGACACGACAAACCACTTTCTGCCCCTGGATGAGCTGGAGCACAGCCTGGGGGAGAGTGCGGCCCAGGGGGCAGCTGGAGTGGTGCTCTGGGTGAGCTGGGAAAATACAAGAACCAAGGAATCATGTCAGGCCATCAAGGAGTATATGGACACTACACTGGGGCCCTTCATCCTGAACGTGACCAGTGGGGCCCTTCTCTGCAGTCAAGCCCTGTGCTCCGGCCATGGCCGCTGTGTCCGCCGCACCAGCCACCCCAAAGCCCTCCTCCTCCTTAACCCTGCCAGTTTCTCCATCCAGCTCACGCCTGGTGGTGGGCCCCTGAGCCTGCGGGGTGCCCTCTCACTTGAAGATCAGGCACAGATGGCTGTGGAGTTCAAATGTCGATGCTACCCTGGCTGGCAGGCACCGTGGTGTGAGCGGAAGAGCATGTGGTGA
ORF Protein Sequence MAAHLLPICALFLTLLDMAQGFRGPLLPNRPFTTVWNANTQWCLERHGVDVDVSVFDVVANPGQTFRGPDMTIFYSSQLGTYPYYTPTGEPVFGGLPQNASLIAHLARTFQDILAAIPAPDFSGLAVIDWEAWRPRWAFNWDTKDIYRQRSRALVQAQHPDWPAPQVEAVAQDQFQGAARAWMAGTLQLGRALRPRGLWGFYGFPDCYNYDFLSPNYTGQCPSGIRAQNDQLGWLWGQSRALYPSIYMPAVLEGTGKSQMYVQHRVAEAFRVAVAAGDPNLPVLPYVQIFYDTTNHFLPLDELEHSLGESAAQGAAGVVLWVSWENTRTKESCQAIKEYMDTTLGPFILNVTSGALLCSQALCSGHGRCVRRTSHPKALLLLNPASFSIQLTPGGGPLSLRGALSLEDQAQMAVEFKCRCYPGWQAPWCERKSMW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0973-Ab Anti-HYAL1/ HYAL-1/ LUCA1 functional antibody
    Target Antigen GM-Tg-g-SE0973-Ag HYAL1 protein
    ORF Viral Vector pGMLP000113 Human HYAL1 Lentivirus plasmid
    ORF Viral Vector vGMLP000113 Human HYAL1 Lentivirus particle


    Target information

    Target ID GM-SE0973
    Target Name HYAL1
    Gene ID 3373, 15586, 702850, 367166, 608602, 515397
    Gene Symbol and Synonyms Fus2,Hya1,HYAL-1,HYAL1,LUCA1,MPS9,NAT6
    Uniprot Accession Q12794
    Uniprot Entry Name HYAL1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000114378
    Target Classification Not Available

    This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.