Human HLA-DRB5 ORF/cDNA clone-Lentivirus particle (NM_002125)

Cat. No.: vGMLP000128

Pre-made Human HLA-DRB5/ Lentiviral expression plasmid for HLA-DRB5 lentivirus packaging, HLA-DRB5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to HLA-DRB5/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000128 Human HLA-DRB5 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000128
Gene Name HLA-DRB5
Accession Number NM_002125
Gene ID 3127
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 801 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGTGTCTGAAGCTCCCTGGAGGTTCCTACATGGCAAAGCTGACAGTGACACTGATGGTGCTGAGCTCCCCACTGGCTTTGGCTGGGGACACCCGACCACGTTTCTTGCAGCAGGATAAGTATGAGTGTCATTTCTTCAACGGGACGGAGCGGGTGCGGTTCCTGCACAGAGACATCTATAACCAAGAGGAGGACTTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGGAGCTGGGGCGGCCTGACGCTGAGTACTGGAACAGCCAGAAGGACTTCCTGGAAGACAGGCGCGCCGCGGTGGACACCTACTGCAGACACAACTACGGGGTTGGTGAGAGCTTCACAGTGCAGCGGCGAGTTGAGCCTAAGGTGACTGTGTATCCTGCAAGGACCCAGACCCTGCAGCACCACAACCTCCTGGTCTGCTCTGTGAATGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACAGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATTCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGAAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACGAGCCCTCTCACAGTGGAATGGAGAGCACAGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTATTCATCTACTTCAAGAATCAGAAAGGGCACTCTGGACTTCACCCAACAGGACTCGTGAGCTGA
ORF Protein Sequence MVCLKLPGGSYMAKLTVTLMVLSSPLALAGDTRPRFLQQDKYECHFFNGTERVRFLHRDIYNQEEDLRFDSDVGEYRAVTELGRPDAEYWNSQKDFLEDRRAAVDTYCRHNYGVGESFTVQRRVEPKVTVYPARTQTLQHHNLLVCSVNGFYPGSIEVRWFRNSQEEKAGVVSTGLIQNGDWTFQTLVMLETVPRSGEVYTCQVEHPSVTSPLTVEWRAQSESAQSKMLSGVGGFVLGLLFLGAGLFIYFKNQKGHSGLHPTGLVS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA180-Ab Anti-DRB5/ HLA-DRB5 monoclonal antibody
    Target Antigen GM-Tg-g-TA180-Ag HLA-DRB5 VLP (virus-like particle)
    ORF Viral Vector pGMLP000128 Human HLA-DRB5 Lentivirus plasmid
    ORF Viral Vector vGMLP000128 Human HLA-DRB5 Lentivirus particle


    Target information

    Target ID GM-TA180
    Target Name HLA-DRB5
    Gene ID 3127
    Gene Symbol and Synonyms DRB5,HLA-DRB5,HLA-DRB5*
    Uniprot Accession Q30154
    Uniprot Entry Name DRB5_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000198502
    Target Classification Not Available

    HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. There are multiple pseudogenes of this gene. [provided by RefSeq, Feb 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.