Human IL23A/IL-23/ IL-23A ORF/cDNA clone-Lentivirus particle (NM_016584)

Pre-made Human IL23A/IL-23/ IL-23A Lentiviral expression plasmid for IL23A lentivirus packaging, IL23A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL23/IL23A/IL-23 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000160 Human IL23A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000160
Gene Name IL23A
Accession Number NM_016584
Gene ID 51561
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 570 bp
Gene Alias IL-23, IL-23A, IL23P19, P19, SGRF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGGGGAGCAGAGCTGTAATGCTGCTGTTGCTGCTGCCCTGGACAGCTCAGGGCAGAGCTGTGCCTGGGGGCAGCAGCCCTGCCTGGACTCAGTGCCAGCAGCTTTCACAGAAGCTCTGCACACTGGCCTGGAGTGCACATCCACTAGTGGGACACATGGATCTAAGAGAAGAGGGAGATGAAGAGACTACAAATGATGTTCCCCATATCCAGTGTGGAGATGGCTGTGACCCCCAAGGACTCAGGGACAACAGTCAGTTCTGCTTGCAAAGGATCCACCAGGGTCTGATTTTTTATGAGAAGCTGCTAGGATCGGATATTTTCACAGGGGAGCCTTCTCTGCTCCCTGATAGCCCTGTGGGCCAGCTTCATGCCTCCCTACTGGGCCTCAGCCAACTCCTGCAGCCTGAGGGTCACCACTGGGAGACTCAGCAGATTCCAAGCCTCAGTCCCAGCCAGCCATGGCAGCGTCTCCTTCTCCGCTTCAAAATCCTTCGCAGCCTCCAGGCCTTTGTGGCTGTAGCCGCCCGGGTCTTTGCCCATGGAGCAGCAACCCTGAGTCCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-573 Pre-Made Tildrakizumab biosimilar, Whole mAb, Anti-IL23A/IL23 Antibody: Anti-IL23P19/P19/SGRF therapeutic antibody
    Biosimilar GMP-Bios-ab-347 Pre-Made Mirikizumab biosimilar, Whole mAb, Anti-IL23A/IL23 Antibody: Anti-IL23P19/P19/SGRF therapeutic antibody
    Biosimilar GMP-Bios-ab-079 Pre-Made Brazikumab biosimilar, Whole mAb, Anti-IL23A/IL23 Antibody: Anti-IL23P19/P19/SGRF therapeutic antibody
    Biosimilar GMP-Bios-ab-486 Pre-Made Risankizumab biosimilar, Whole mAb, Anti-IL23A/IL23 Antibody: Anti-IL23P19/P19/SGRF therapeutic antibody
    Biosimilar GMP-Bios-ab-255 Pre-Made Guselkumab biosimilar, Whole mAb, Anti-IL23A/IL23 Antibody: Anti-IL23P19/P19/SGRF therapeutic antibody
    Target Antibody GM-Tg-g-T06841-Ab Anti-IL23A/ IL23/ IL-23 functional antibody
    Target Antigen GM-Tg-g-T06841-Ag IL23/IL23A protein
    Cytokine cks-Tg-g-GM-T06841 Interleukin 23, alpha subunit p19 (IL23A) protein & antibody
    ORF Viral Vector pGMLP000160 Human IL23A Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-030 Human IL23A Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-113 Human IL23A Adenovirus plasmid
    ORF Viral Vector vGMLP000160 Human IL23A Lentivirus particle
    ORF Viral Vector vGMLP-IL-030 Human IL23A Lentivirus particle
    ORF Viral Vector vGMAP-IL-113 Human IL23A Adenovirus particle


    Target information

    Target ID GM-T06841
    Target Name IL23
    Gene ID 51561, 83430, 712627, 155140, 654423, 481110, 511022, 100034230
    Gene Symbol and Synonyms IL-23,IL-23A,IL23,IL23A,IL23P19,P19,SGRF
    Uniprot Accession Q9NPF7
    Uniprot Entry Name IL23A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000110944
    Target Classification Not Available

    This gene encodes a subunit of the heterodimeric cytokine interleukin 23 (IL23). IL23 is composed of this protein and the p40 subunit of interleukin 12 (IL12B). The receptor of IL23 is formed by the beta 1 subunit of IL12 (IL12RB1) and an IL23 specific subunit, IL23R. Both IL23 and IL12 can activate the transcription activator STAT4, and stimulate the production of interferon-gamma (IFNG). In contrast to IL12, which acts mainly on naive CD4(+) T cells, IL23 preferentially acts on memory CD4(+) T cells. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.