Human FCER1A/FCE1A/FcERI ORF/cDNA clone-Lentivirus particle (NM_002001)
Cat. No.: vGMLP000440
Pre-made Human FCER1A/FCE1A/FcERI Lentiviral expression plasmid for FCER1A lentivirus packaging, FCER1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
FCER1A/FCE1A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000440 | Human FCER1A Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000440 |
Gene Name | FCER1A |
Accession Number | NM_002001 |
Gene ID | 2205 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 774 bp |
Gene Alias | FCE1A,FcERI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTCCTGCCATGGAATCCCCTACTCTACTGTGTGTAGCCTTACTGTTCTTCGCTCCAGATGGCGTGTTAGCAGTCCCTCAGAAACCTAAGGTCTCCTTGAACCCTCCATGGAATAGAATATTTAAAGGAGAGAATGTGACTCTTACATGTAATGGGAACAATTTCTTTGAAGTCAGTTCCACCAAATGGTTCCACAATGGCAGCCTTTCAGAAGAGACAAATTCAAGTTTGAATATTGTGAATGCCAAATTTGAAGACAGTGGAGAATACAAATGTCAGCACCAACAAGTTAATGAGAGTGAACCTGTGTACCTGGAAGTCTTCAGTGACTGGCTGCTCCTTCAGGCCTCTGCTGAGGTGGTGATGGAGGGCCAGCCCCTCTTCCTCAGGTGCCATGGTTGGAGGAACTGGGATGTGTACAAGGTGATCTATTATAAGGATGGTGAAGCTCTCAAGTACTGGTATGAGAACCACAACATCTCCATTACAAATGCCACAGTTGAAGACAGTGGAACCTACTACTGTACGGGCAAAGTGTGGCAGCTGGACTATGAGTCTGAGCCCCTCAACATTACTGTAATAAAAGCTCCGCGTGAGAAGTACTGGCTACAATTTTTTATCCCATTGTTGGTGGTGATTCTGTTTGCTGTGGACACAGGATTATTTATCTCAACTCAGCAGCAGGTCACATTTCTCTTGAAGATTAAGAGAACCAGGAAAGGCTTCAGACTTCTGAACCCACATCCTAAGCCAAACCCCAAAAACAACTGA |
ORF Protein Sequence | MAPAMESPTLLCVALLFFAPDGVLAVPQKPKVSLNPPWNRIFKGENVTLTCNGNNFFEVSSTKWFHNGSLSEETNSSLNIVNAKFEDSGEYKCQHQQVNESEPVYLEVFSDWLLLQASAEVVMEGQPLFLRCHGWRNWDVYKVIYYKDGEALKYWYENHNISITNATVEDSGTYYCTGKVWQLDYESEPLNITVIKAPREKYWLQFFIPLLVVILFAVDTGLFISTQQQVTFLLKIKRTRKGFRLLNPHPKPNPKNN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0438-Ab | Anti-FCERA/ FCER1A/ FCE1A monoclonal antibody |
Target Antigen | GM-Tg-g-MP0438-Ag | FCER1A VLP (virus-like particle) |
ORF Viral Vector | pGMLP000440 | Human FCER1A Lentivirus plasmid |
ORF Viral Vector | vGMLP000440 | Human FCER1A Lentivirus particle |
Target information
Target ID | GM-MP0438 |
Target Name | FCER1A |
Gene ID | 2205, 14125, 719324, 25047, 101094323, 478970, 506783, 100057308 |
Gene Symbol and Synonyms | FCE1A,fcepsilonri,FCER1A,FcERI,FCERIA,Fcr-5,Iger01,RATIGER01 |
Uniprot Accession | P12319 |
Uniprot Entry Name | FCERA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000179639 |
Target Classification | Not Available |
The immunoglobulin epsilon receptor (IgE receptor) is the initiator of the allergic response. When two or more high-affinity IgE receptors are brought together by allergen-bound IgE molecules, mediators such as histamine that are responsible for allergy symptoms are released. This receptor is comprised of an alpha subunit, a beta subunit, and two gamma subunits. The protein encoded by this gene represents the alpha subunit. [provided by RefSeq, Aug 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.