Human FCER1A/FCE1A/FcERI ORF/cDNA clone-Lentivirus particle (NM_002001)

Cat. No.: vGMLP000440

Pre-made Human FCER1A/FCE1A/FcERI Lentiviral expression plasmid for FCER1A lentivirus packaging, FCER1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to FCER1A/FCE1A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000440 Human FCER1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000440
Gene Name FCER1A
Accession Number NM_002001
Gene ID 2205
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 774 bp
Gene Alias FCE1A,FcERI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCCTGCCATGGAATCCCCTACTCTACTGTGTGTAGCCTTACTGTTCTTCGCTCCAGATGGCGTGTTAGCAGTCCCTCAGAAACCTAAGGTCTCCTTGAACCCTCCATGGAATAGAATATTTAAAGGAGAGAATGTGACTCTTACATGTAATGGGAACAATTTCTTTGAAGTCAGTTCCACCAAATGGTTCCACAATGGCAGCCTTTCAGAAGAGACAAATTCAAGTTTGAATATTGTGAATGCCAAATTTGAAGACAGTGGAGAATACAAATGTCAGCACCAACAAGTTAATGAGAGTGAACCTGTGTACCTGGAAGTCTTCAGTGACTGGCTGCTCCTTCAGGCCTCTGCTGAGGTGGTGATGGAGGGCCAGCCCCTCTTCCTCAGGTGCCATGGTTGGAGGAACTGGGATGTGTACAAGGTGATCTATTATAAGGATGGTGAAGCTCTCAAGTACTGGTATGAGAACCACAACATCTCCATTACAAATGCCACAGTTGAAGACAGTGGAACCTACTACTGTACGGGCAAAGTGTGGCAGCTGGACTATGAGTCTGAGCCCCTCAACATTACTGTAATAAAAGCTCCGCGTGAGAAGTACTGGCTACAATTTTTTATCCCATTGTTGGTGGTGATTCTGTTTGCTGTGGACACAGGATTATTTATCTCAACTCAGCAGCAGGTCACATTTCTCTTGAAGATTAAGAGAACCAGGAAAGGCTTCAGACTTCTGAACCCACATCCTAAGCCAAACCCCAAAAACAACTGA
ORF Protein Sequence MAPAMESPTLLCVALLFFAPDGVLAVPQKPKVSLNPPWNRIFKGENVTLTCNGNNFFEVSSTKWFHNGSLSEETNSSLNIVNAKFEDSGEYKCQHQQVNESEPVYLEVFSDWLLLQASAEVVMEGQPLFLRCHGWRNWDVYKVIYYKDGEALKYWYENHNISITNATVEDSGTYYCTGKVWQLDYESEPLNITVIKAPREKYWLQFFIPLLVVILFAVDTGLFISTQQQVTFLLKIKRTRKGFRLLNPHPKPNPKNN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0438-Ab Anti-FCERA/ FCER1A/ FCE1A monoclonal antibody
    Target Antigen GM-Tg-g-MP0438-Ag FCER1A VLP (virus-like particle)
    ORF Viral Vector pGMLP000440 Human FCER1A Lentivirus plasmid
    ORF Viral Vector vGMLP000440 Human FCER1A Lentivirus particle


    Target information

    Target ID GM-MP0438
    Target Name FCER1A
    Gene ID 2205, 14125, 719324, 25047, 101094323, 478970, 506783, 100057308
    Gene Symbol and Synonyms FCE1A,fcepsilonri,FCER1A,FcERI,FCERIA,Fcr-5,Iger01,RATIGER01
    Uniprot Accession P12319
    Uniprot Entry Name FCERA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000179639
    Target Classification Not Available

    The immunoglobulin epsilon receptor (IgE receptor) is the initiator of the allergic response. When two or more high-affinity IgE receptors are brought together by allergen-bound IgE molecules, mediators such as histamine that are responsible for allergy symptoms are released. This receptor is comprised of an alpha subunit, a beta subunit, and two gamma subunits. The protein encoded by this gene represents the alpha subunit. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.