Human GADD45G/CR6/ DDIT2 ORF/cDNA clone-Lentivirus particle (NM_006705)

Pre-made Human GADD45G/CR6/ DDIT2 Lentiviral expression plasmid for GADD45G lentivirus packaging, GADD45G lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to GADD45G/CR6 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000504 Human GADD45G Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000504
Gene Name GADD45G
Accession Number NM_006705
Gene ID 10912
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 480 bp
Gene Alias CR6, DDIT2, GADD45gamma, GRP17
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTCTGGAAGAAGTCCGCGGCCAGGACACAGTTCCGGAAAGCACAGCCAGGATGCAGGGTGCCGGGAAAGCGCTGCATGAGTTGCTGCTGTCGGCGCAGCGTCAGGGCTGCCTCACTGCCGGCGTCTACGAGTCAGCCAAAGTCTTGAACGTGGACCCCGACAATGTGACCTTCTGTGTGCTGGCTGCGGGTGAGGAGGACGAGGGCGACATCGCGCTGCAGATCCATTTTACGCTGATCCAGGCTTTCTGCTGCGAGAACGACATCGACATAGTGCGCGTGGGCGATGTGCAGCGGCTGGCGGCTATCGTGGGCGCCGGCGAGGAGGCGGGTGCGCCGGGCGACCTGCACTGCATCCTCATTTCGAACCCCAACGAGGACGCCTGGAAGGATCCCGCCTTGGAGAAGCTCAGCCTGTTTTGCGAGGAGAGCCGCAGCGTTAACGACTGGGTGCCCAGCATCACCCTCCCCGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA138-Ab Anti-GADD45G monoclonal antibody
    Target Antigen GM-Tg-g-TA138-Ag GADD45G protein
    ORF Viral Vector pGMLV000185 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMLV000519 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMAD001207 Rat Gadd45g Adenovirus plasmid
    ORF Viral Vector pGMLP000504 Human GADD45G Lentivirus plasmid
    ORF Viral Vector pGMAP000097 Human GADD45G Adenovirus plasmid
    ORF Viral Vector vGMLV000185 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMLV000519 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMAD001207 Rat Gadd45g Adenovirus particle
    ORF Viral Vector vGMLP000504 Human GADD45G Lentivirus particle
    ORF Viral Vector vGMAP000097 Human GADD45G Adenovirus particle


    Target information

    Target ID GM-TA138
    Target Name GADD45G
    Gene ID 10912, 23882, 697835, 291005, 101086509, 484198, 504939, 100054996
    Gene Symbol and Synonyms CR6,DDIT2,GADD45G,GADD45gamma,GRP17,OIG37
    Uniprot Accession O95257
    Uniprot Entry Name GA45G_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000130222
    Target Classification Not Available

    This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The GADD45G is highly expressed in placenta. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.