Human CXCL2/CINC-2a/ GRO2 ORF/cDNA clone-Lentivirus particle (NM_002089)
Pre-made Human CXCL2/CINC-2a/ GRO2 Lentiviral expression plasmid for CXCL2 lentivirus packaging, CXCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CXCL2/CINC-2a products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000632 | Human CXCL2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000632 |
Gene Name | CXCL2 |
Accession Number | NM_002089 |
Gene ID | 2920 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 324 bp |
Gene Alias | CINC-2a, GRO2, GROb, MGSA-b, MIP-2a, MIP2, MIP2A, SCYB2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCGCGCCACGCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGGGTGGCGCTGCTGCTCCTGCTCCTGGTGGCCGCCAGCCGGCGCGCAGCAGGAGCGCCCCTGGCCACTGAACTGCGCTGCCAGTGCTTGCAGACCCTGCAGGGAATTCACCTCAAGAACATCCAAAGTGTGAAGGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCAGAAAGCTTGTCTCAACCCCGCATCGCCCATGGTTAAGAAAATCATCGAAAAGATGCTGAAAAATGGCAAATCCAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T96627-Ab | Anti-CXCL2/ CINC-2a/ GRO2 functional antibody |
Target Antigen | GM-Tg-g-T96627-Ag | CXCL2 protein |
Cytokine | cks-Tg-g-GM-T96627 | chemokine (C-X-C motif) ligand 2 (CXCL2) protein & antibody |
ORF Viral Vector | pGMLP000632 | Human CXCL2 Lentivirus plasmid |
ORF Viral Vector | vGMLP000632 | Human CXCL2 Lentivirus particle |
Target information
Target ID | GM-T96627 |
Target Name | CXCL2 |
Gene ID | 2920 |
Gene Symbol and Synonyms | CINC-2a,CXCL2,GRO2,GROb,MGSA-b,MIP-2a,MIP2,MIP2A,SCYB2 |
Uniprot Accession | P19875 |
Uniprot Entry Name | CXCL2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000081041 |
Target Classification | Not Available |
This antimicrobial gene is part of a chemokine superfamily that encodes secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CXC subfamily, is expressed at sites of inflammation and may suppress hematopoietic progenitor cell proliferation. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.