Human CXCL2/CINC-2a/ GRO2 ORF/cDNA clone-Lentivirus particle (NM_002089)

Pre-made Human CXCL2/CINC-2a/ GRO2 Lentiviral expression plasmid for CXCL2 lentivirus packaging, CXCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CXCL2/CINC-2a products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000632 Human CXCL2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000632
Gene Name CXCL2
Accession Number NM_002089
Gene ID 2920
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 324 bp
Gene Alias CINC-2a, GRO2, GROb, MGSA-b, MIP-2a, MIP2, MIP2A, SCYB2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCGCGCCACGCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGGGTGGCGCTGCTGCTCCTGCTCCTGGTGGCCGCCAGCCGGCGCGCAGCAGGAGCGCCCCTGGCCACTGAACTGCGCTGCCAGTGCTTGCAGACCCTGCAGGGAATTCACCTCAAGAACATCCAAAGTGTGAAGGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCAGAAAGCTTGTCTCAACCCCGCATCGCCCATGGTTAAGAAAATCATCGAAAAGATGCTGAAAAATGGCAAATCCAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T96627-Ab Anti-CXCL2/ CINC-2a/ GRO2 functional antibody
    Target Antigen GM-Tg-g-T96627-Ag CXCL2 protein
    Cytokine cks-Tg-g-GM-T96627 chemokine (C-X-C motif) ligand 2 (CXCL2) protein & antibody
    ORF Viral Vector pGMLP000632 Human CXCL2 Lentivirus plasmid
    ORF Viral Vector vGMLP000632 Human CXCL2 Lentivirus particle


    Target information

    Target ID GM-T96627
    Target Name CXCL2
    Gene ID 2920
    Gene Symbol and Synonyms CINC-2a,CXCL2,GRO2,GROb,MGSA-b,MIP-2a,MIP2,MIP2A,SCYB2
    Uniprot Accession P19875
    Uniprot Entry Name CXCL2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000081041
    Target Classification Not Available

    This antimicrobial gene is part of a chemokine superfamily that encodes secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CXC subfamily, is expressed at sites of inflammation and may suppress hematopoietic progenitor cell proliferation. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.