Human CLDN11/OSP/OTM ORF/cDNA clone-Lentivirus particle (NM_005602)

Cat. No.: vGMLP000641

Pre-made Human CLDN11/OSP/OTM Lentiviral expression plasmid for CLDN11 lentivirus packaging, CLDN11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CLDN11/OSP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000641 Human CLDN11 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000641
Gene Name CLDN11
Accession Number NM_005602
Gene ID 5010
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 624 bp
Gene Alias OSP,OTM
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGGCCACGTGCCTGCAGGTGGTGGGCTTCGTCACGAGCTTCGTGGGCTGGATCGGGGTCATCGTGACCACCTCCACCAATGACTGGGTGGTGACCTGCGGCTACACCATCCCCACCTGCCGCAAGCTGGATGAGCTGGGCTCCAAGGGGCTGTGGGCCGACTGCGTCATGGCCACGGGGCTGTACCACTGCAAGCCCCTGGTGGACATCCTCATCCTGCCGGGCTACGTGCAGGCCTGCCGCGCCCTGATGATTGCTGCCTCGGTCCTGGGTCTGCCGGCCATTTTACTGCTGCTGACTGTTCTTCCCTGCATCCGGATGGGCCAGGAGCCCGGTGTGGCTAAGTACAGGCGGGCCCAGCTGGCTGGTGTTTTGCTCATTCTGCTGGCTCTCTGCGCCCTTGTTGCCACCATCTGGTTCCCTGTGTGCGCCCACCGTGAGACCACCATCGTGAGCTTTGGCTACTCCCTGTATGCAGGCTGGATTGGTGCTGTGCTGTGCCTCGTGGGTGGCTGTGTCATCCTCTGCTGCGCTGGAGATGCCCAGGCCTTTGGTGAAAACCGTTTCTACTACACTGCGGGCTCTAGCTCCCCGACTCATGCGAAGAGTGCCCACGTATAA
ORF Protein Sequence MVATCLQVVGFVTSFVGWIGVIVTTSTNDWVVTCGYTIPTCRKLDELGSKGLWADCVMATGLYHCKPLVDILILPGYVQACRALMIAASVLGLPAILLLLTVLPCIRMGQEPGVAKYRRAQLAGVLLILLALCALVATIWFPVCAHRETTIVSFGYSLYAGWIGAVLCLVGGCVILCCAGDAQAFGENRFYYTAGSSSPTHAKSAHV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0272-Ab Anti-CLD11/ CLDN11/ OSP monoclonal antibody
    Target Antigen GM-Tg-g-MP0272-Ag CLDN11 VLP (virus-like particle)
    ORF Viral Vector pGMLP000641 Human CLDN11 Lentivirus plasmid
    ORF Viral Vector vGMLP000641 Human CLDN11 Lentivirus particle


    Target information

    Target ID GM-MP0272
    Target Name CLDN11
    Gene ID 5010, 18417, 696363, 84588, 101086744, 488160, 508268, 100057644
    Gene Symbol and Synonyms Claudin-11,Claudin11,CLDN11,HLD22,OSP,OTM
    Uniprot Accession O75508
    Uniprot Entry Name CLD11_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000013297
    Target Classification Not Available

    This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a major component of central nervous system (CNS) myelin and plays an important role in regulating proliferation and migration of oligodendrocytes. Mouse studies showed that the gene deficiency results in deafness and loss of the Sertoli cell epithelial phenotype in the testis. This protein is a tight junction protein at the human blood-testis barrier (BTB), and the BTB disruption is related to a dysfunction of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Aug 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.