Human CHRM1/HM1/ M1 ORF/cDNA clone-Lentivirus particle (NM_000738)
Pre-made Human CHRM1/HM1/ M1 Lentiviral expression plasmid for CHRM1 lentivirus packaging, CHRM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CHRM1/HM1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000649 | Human CHRM1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000649 |
Gene Name | CHRM1 |
Accession Number | NM_000738 |
Gene ID | 1128 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1383 bp |
Gene Alias | HM1, M1, M1R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACACTTCAGCCCCACCTGCTGTCAGCCCCAACATCACCGTCCTGGCACCAGGAAAGGGTCCCTGGCAAGTGGCCTTCATTGGGATCACCACGGGCCTCCTGTCGCTAGCCACAGTGACAGGCAACCTGCTGGTACTCATCTCTTTCAAGGTCAACACGGAGCTCAAGACAGTCAATAACTACTTCCTGCTGAGCCTGGCCTGTGCTGACCTCATCATCGGTACCTTCTCCATGAACCTCTATACCACGTACCTGCTCATGGGCCACTGGGCTCTGGGCACGCTGGCTTGTGACCTCTGGCTGGCCCTGGACTATGTGGCCAGCAATGCCTCCGTCATGAATCTGCTGCTCATCAGCTTTGACCGCTACTTCTCCGTGACTCGGCCCCTGAGCTACCGTGCCAAGCGCACACCCCGCCGGGCAGCTCTGATGATCGGCCTGGCCTGGCTGGTTTCCTTTGTGCTCTGGGCCCCAGCCATCCTCTTCTGGCAGTACCTGGTAGGGGAGCGGACAGTGCTAGCTGGGCAGTGCTACATCCAGTTCCTCTCCCAGCCCATCATCACCTTTGGCACAGCCATGGCTGCCTTCTACCTCCCTGTCACAGTCATGTGCACGCTCTACTGGCGCATCTACCGGGAGACAGAGAACCGAGCACGGGAGCTGGCAGCCCTTCAGGGCTCCGAGACGCCAGGCAAAGGGGGTGGCAGCAGCAGCAGCTCAGAGAGGTCTCAGCCAGGGGCTGAGGGCTCACCAGAGACTCCTCCAGGCCGCTGCTGTCGCTGCTGCCGGGCCCCCAGGCTGCTGCAGGCCTACAGCTGGAAGGAAGAAGAGGAAGAGGACGAAGGCTCCATGGAGTCCCTCACATCCTCAGAGGGAGAGGAGCCTGGCTCCGAAGTGGTGATCAAGATGCCAATGGTGGACCCCGAGGCACAGGCCCCCACCAAGCAGCCCCCACGGAGCTCCCCAAATACAGTCAAGAGGCCGACTAAGAAAGGGCGTGATCGAGCTGGCAAGGGCCAGAAGCCCCGTGGAAAGGAGCAGCTGGCCAAGCGGAAGACCTTCTCGCTGGTCAAGGAGAAGAAGGCGGCTCGGACCCTGAGTGCCATCCTCCTGGCCTTCATCCTCACCTGGACACCGTACAACATCATGGTGCTGGTGTCCACCTTCTGCAAGGACTGTGTTCCCGAGACCCTGTGGGAGCTGGGCTACTGGCTGTGCTACGTCAACAGCACCATCAACCCCATGTGCTACGCACTCTGCAACAAAGCCTTCCGGGACACCTTTCGCCTGCTGCTGCTTTGCCGCTGGGACAAGAGACGCTGGCGCAAGATCCCCAAGCGCCCTGGCTCCGTGCACCGCACTCCCTCCCGCCAATGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T28893-Ab | Anti-ACM1/ CHRM1/ HM1 monoclonal antibody |
Target Antigen | GM-Tg-g-T28893-Ag | CHRM1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000649 | Human CHRM1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000649 | Human CHRM1 Lentivirus particle |
Target information
Target ID | GM-T28893 |
Target Name | CHRM1 |
Gene ID | 1128, 12669, 574362, 25229, 101093801, 483776, 281684, 100064117 |
Gene Symbol and Synonyms | Chrm-1,CHRM1,HM1,M1,M1R |
Uniprot Accession | P11229 |
Uniprot Entry Name | ACM1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000168539 |
Target Classification | Not Available |
The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.