Human CHRM1/HM1/ M1 ORF/cDNA clone-Lentivirus particle (NM_000738)

Pre-made Human CHRM1/HM1/ M1 Lentiviral expression plasmid for CHRM1 lentivirus packaging, CHRM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CHRM1/HM1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000649 Human CHRM1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000649
Gene Name CHRM1
Accession Number NM_000738
Gene ID 1128
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1383 bp
Gene Alias HM1, M1, M1R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACACTTCAGCCCCACCTGCTGTCAGCCCCAACATCACCGTCCTGGCACCAGGAAAGGGTCCCTGGCAAGTGGCCTTCATTGGGATCACCACGGGCCTCCTGTCGCTAGCCACAGTGACAGGCAACCTGCTGGTACTCATCTCTTTCAAGGTCAACACGGAGCTCAAGACAGTCAATAACTACTTCCTGCTGAGCCTGGCCTGTGCTGACCTCATCATCGGTACCTTCTCCATGAACCTCTATACCACGTACCTGCTCATGGGCCACTGGGCTCTGGGCACGCTGGCTTGTGACCTCTGGCTGGCCCTGGACTATGTGGCCAGCAATGCCTCCGTCATGAATCTGCTGCTCATCAGCTTTGACCGCTACTTCTCCGTGACTCGGCCCCTGAGCTACCGTGCCAAGCGCACACCCCGCCGGGCAGCTCTGATGATCGGCCTGGCCTGGCTGGTTTCCTTTGTGCTCTGGGCCCCAGCCATCCTCTTCTGGCAGTACCTGGTAGGGGAGCGGACAGTGCTAGCTGGGCAGTGCTACATCCAGTTCCTCTCCCAGCCCATCATCACCTTTGGCACAGCCATGGCTGCCTTCTACCTCCCTGTCACAGTCATGTGCACGCTCTACTGGCGCATCTACCGGGAGACAGAGAACCGAGCACGGGAGCTGGCAGCCCTTCAGGGCTCCGAGACGCCAGGCAAAGGGGGTGGCAGCAGCAGCAGCTCAGAGAGGTCTCAGCCAGGGGCTGAGGGCTCACCAGAGACTCCTCCAGGCCGCTGCTGTCGCTGCTGCCGGGCCCCCAGGCTGCTGCAGGCCTACAGCTGGAAGGAAGAAGAGGAAGAGGACGAAGGCTCCATGGAGTCCCTCACATCCTCAGAGGGAGAGGAGCCTGGCTCCGAAGTGGTGATCAAGATGCCAATGGTGGACCCCGAGGCACAGGCCCCCACCAAGCAGCCCCCACGGAGCTCCCCAAATACAGTCAAGAGGCCGACTAAGAAAGGGCGTGATCGAGCTGGCAAGGGCCAGAAGCCCCGTGGAAAGGAGCAGCTGGCCAAGCGGAAGACCTTCTCGCTGGTCAAGGAGAAGAAGGCGGCTCGGACCCTGAGTGCCATCCTCCTGGCCTTCATCCTCACCTGGACACCGTACAACATCATGGTGCTGGTGTCCACCTTCTGCAAGGACTGTGTTCCCGAGACCCTGTGGGAGCTGGGCTACTGGCTGTGCTACGTCAACAGCACCATCAACCCCATGTGCTACGCACTCTGCAACAAAGCCTTCCGGGACACCTTTCGCCTGCTGCTGCTTTGCCGCTGGGACAAGAGACGCTGGCGCAAGATCCCCAAGCGCCCTGGCTCCGTGCACCGCACTCCCTCCCGCCAATGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T28893-Ab Anti-ACM1/ CHRM1/ HM1 monoclonal antibody
    Target Antigen GM-Tg-g-T28893-Ag CHRM1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000649 Human CHRM1 Lentivirus plasmid
    ORF Viral Vector vGMLP000649 Human CHRM1 Lentivirus particle


    Target information

    Target ID GM-T28893
    Target Name CHRM1
    Gene ID 1128, 12669, 574362, 25229, 101093801, 483776, 281684, 100064117
    Gene Symbol and Synonyms Chrm-1,CHRM1,HM1,M1,M1R
    Uniprot Accession P11229
    Uniprot Entry Name ACM1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000168539
    Target Classification Not Available

    The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.