Human FGFRL1/FGFR5/ FHFR ORF/cDNA clone-Lentivirus particle (NM_021923)
Pre-made Human FGFRL1/FGFR5/ FHFR Lentiviral expression plasmid for FGFRL1 lentivirus packaging, FGFRL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FGFRL1/FGFR5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000660 | Human FGFRL1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000660 |
Gene Name | FGFRL1 |
Accession Number | NM_021923 |
Gene ID | 53834 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1515 bp |
Gene Alias | FGFR5, FHFR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACGCCGAGCCCCCTGTTGCTGCTCCTGCTGCCGCCGCTGCTGCTGGGGGCCTTCCCGCCGGCCGCCGCCGCCCGAGGCCCCCCAAAGATGGCGGACAAGGTGGTCCCACGGCAGGTGGCCCGGCTGGGCCGCACTGTGCGGCTGCAGTGCCCAGTGGAGGGGGACCCGCCGCCGCTGACCATGTGGACCAAGGATGGCCGCACCATCCACAGCGGCTGGAGCCGCTTCCGCGTGCTGCCGCAGGGGCTGAAGGTGAAGCAGGTGGAGCGGGAGGATGCCGGCGTGTACGTGTGCAAGGCCACCAACGGCTTCGGCAGCCTGAGCGTCAACTACACCCTCGTCGTGCTGGATGACATTAGCCCAGGGAAGGAGAGCCTGGGGCCCGACAGCTCCTCTGGGGGTCAAGAGGACCCCGCCAGCCAGCAGTGGGCACGACCGCGCTTCACACAGCCCTCCAAGATGAGGCGCCGGGTGATCGCACGGCCCGTGGGTAGCTCCGTGCGGCTCAAGTGCGTGGCCAGCGGGCACCCTCGGCCCGACATCACGTGGATGAAGGACGACCAGGCCTTGACGCGCCCAGAGGCCGCTGAGCCCAGGAAGAAGAAGTGGACACTGAGCCTGAAGAACCTGCGGCCGGAGGACAGCGGCAAATACACCTGCCGCGTGTCGAACCGCGCGGGCGCCATCAACGCCACCTACAAGGTGGATGTGATCCAGCGGACCCGTTCCAAGCCCGTGCTCACAGGCACGCACCCCGTGAACACGACGGTGGACTTCGGGGGGACCACGTCCTTCCAGTGCAAGGTGCGCAGCGACGTGAAGCCGGTGATCCAGTGGCTGAAGCGCGTGGAGTACGGCGCCGAGGGCCGCCACAACTCCACCATCGATGTGGGCGGCCAGAAGTTTGTGGTGCTGCCCACGGGTGACGTGTGGTCGCGGCCCGACGGCTCCTACCTCAATAAGCTGCTCATCACCCGTGCCCGCCAGGACGATGCGGGCATGTACATCTGCCTTGGCGCCAACACCATGGGCTACAGCTTCCGCAGCGCCTTCCTCACCGTGCTGCCAGACCCAAAACCGCCAGGGCCACCTGTGGCCTCCTCGTCCTCGGCCACTAGCCTGCCGTGGCCCGTGGTCATCGGCATCCCAGCCGGCGCTGTCTTCATCCTGGGCACCCTGCTCCTGTGGCTTTGCCAGGCCCAGAAGAAGCCGTGCACCCCCGCGCCTGCCCCTCCCCTGCCTGGGCACCGCCCGCCGGGGACGGCCCGCGACCGCAGCGGAGACAAGGACCTTCCCTCGTTGGCCGCCCTCAGCGCTGGCCCTGGTGTGGGGCTGTGTGAGGAGCATGGGTCTCCGGCAGCCCCCCAGCACTTACTGGGCCCAGGCCCAGTTGCTGGCCCTAAGTTGTACCCCAAACTCTACACAGACATCCACACACACACACACACACACTCTCACACACACTCACACGTGGAGGGCAAGGTCCACCAGCACATCCACTATCAGTGCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0442-Ab | Anti-FGRL1/ FGFRL1/ FGFR5 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0442-Ag | FGFRL1 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP0442 | fibroblast growth factor receptor-like 1 (FGFRL1) protein & antibody |
ORF Viral Vector | pGMLP000660 | Human FGFRL1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000660 | Human FGFRL1 Lentivirus particle |
Target information
Target ID | GM-MP0442 |
Target Name | FGFRL1 |
Gene ID | 53834, 116701, 702927, 360903, 101095654, 102151155, 532327, 100630904 |
Gene Symbol and Synonyms | FGFR-5,FGFR5,FGFR5beta,FGFR5gamma,FGFRL1,FHFR |
Uniprot Accession | Q8N441 |
Uniprot Entry Name | FGRL1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000127418 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.