Human RABAC1/PRA1/PRAF1 ORF/cDNA clone-Lentivirus particle (NM_006423)

Cat. No.: vGMLP000691

Pre-made Human RABAC1/PRA1/PRAF1 Lentiviral expression plasmid for RABAC1 lentivirus packaging, RABAC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RABAC1/PRA1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000691 Human RABAC1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000691
Gene Name RABAC1
Accession Number NM_006423
Gene ID 10567
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 558 bp
Gene Alias PRA1,PRAF1,YIP3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGCGCAGAAGGACCAGCAGAAAGATGCCGAGGCGGAAGGGCTGAGCGGCACGACCCTGCTGCCGAAGCTGATTCCCTCCGGTGCAGGCCGGGAGTGGCTGGAGCGGCGCCGCGCGACCATCCGGCCCTGGAGCACCTTCGTGGACCAGCAGCGCTTCTCACGGCCCCGCAACCTGGGAGAGCTGTGCCAGCGCCTCGTACGCAACGTGGAGTACTACCAGAGCAACTATGTGTTCGTGTTCCTGGGCCTCATCCTGTACTGTGTGGTGACGTCCCCTATGTTGCTGGTGGCTCTGGCTGTCTTTTTCGGCGCCTGTTACATTCTCTATCTGCGCACCTTGGAGTCCAAGCTTGTGCTCTTTGGCCGAGAGGTGAGCCCAGCGCATCAGTATGCTCTGGCTGGAGGCATCTCCTTCCCCTTCTTCTGGCTGGCTGGTGCGGGCTCGGCCGTCTTCTGGGTGCTGGGAGCCACCCTGGTGGTCATCGGCTCCCACGCTGCCTTCCACCAGATTGAGGCTGTGGACGGGGAGGAGCTGCAGATGGAACCCGTGTGA
ORF Protein Sequence MAAQKDQQKDAEAEGLSGTTLLPKLIPSGAGREWLERRRATIRPWSTFVDQQRFSRPRNLGELCQRLVRNVEYYQSNYVFVFLGLILYCVVTSPMLLVALAVFFGACYILYLRTLESKLVLFGREVSPAHQYALAGGISFPFFWLAGAGSAVFWVLGATLVVIGSHAAFHQIEAVDGEELQMEPV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1446-Ab Anti-PRAF1/ RABAC1/ PRA1 monoclonal antibody
    Target Antigen GM-Tg-g-MP1446-Ag RABAC1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000691 Human RABAC1 Lentivirus plasmid
    ORF Viral Vector vGMLP000691 Human RABAC1 Lentivirus particle


    Target information

    Target ID GM-MP1446
    Target Name RABAC1
    Gene ID 10567, 14470, 706397, 83583, 101083382, 403535, 512653, 100147673
    Gene Symbol and Synonyms 2310040I06Rik,Gbpap1,PRA1,PRAF1,prenylin,RABAC1,YIP3
    Uniprot Accession Q9UI14
    Uniprot Entry Name PRAF1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000105404
    Target Classification Not Available

    Enables identical protein binding activity. Located in membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.