Human COPS6/CSN6/MOV34-34KD ORF/cDNA clone-Lentivirus particle (NM_006833)

Cat. No.: vGMLP000698

Pre-made Human COPS6/CSN6/MOV34-34KD Lentiviral expression plasmid for COPS6 lentivirus packaging, COPS6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to COPS6/CSN6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000698 Human COPS6 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000698
Gene Name COPS6
Accession Number NM_006833
Gene ID 10980
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 984 bp
Gene Alias CSN6,MOV34-34KD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAACGGGACCGGAGGAAGCAGCGGGATGGAGGTGGATGCAGCAGTAGTCCCCAGCGTGATGGCCTGCGGAGTGACTGGGAGTGTTTCCGTCGCTCTCCATCCCCTTGTCATTCTCAACATCTCAGACCACTGGATCCGCATGCGCTCCCAGGAGGGGCGGCCTGTGCAGGTGATTGGGGCTCTGATTGGCAAGCAGGAGGGCCGAAATATCGAGGTGATGAACTCCTTTGAGCTGCTGTCCCACACCGTGGAAGAGAAGATTATCATTGACAAGGAATATTATTACACCAAGGAGGAGCAGTTTAAACAGGTGTTCAAGGAGCTGGAGTTTCTGGGTTGGTATACCACAGGGGGGCCACCTGACCCCTCGGACATCCACGTCCATAAGCAGGTGTGTGAGATCATCGAGAGCCCCCTCTTTCTGAAGTTGAACCCTATGACCAAGCACACAGATCTTCCTGTCAGCGTTTTTGAGTCTGTCATTGATATAATCAATGGAGAGGCCACAATGCTGTTTGCTGAGCTGACCTACACTCTGGCCACAGAGGAAGCGGAACGCATTGGTGTAGACCACGTAGCCCGAATGACAGCAACAGGCAGTGGAGAGAACTCCACTGTGGCTGAACACCTGATAGCACAGCACAGCGCCATCAAGATGCTGCACAGCCGCGTCAAGCTCATCTTGGAGTACGTCAAGGCCTCTGAAGCGGGAGAGGTCCCCTTTAATCATGAGATCCTGCGGGAGGCCTATGCTCTGTGTCACTGTCTCCCGGTGCTCAGCACAGACAAGTTCAAGACAGATTTTTATGATCAATGCAACGACGTGGGGCTCATGGCCTACCTCGGCACCATCACCAAAACGTGCAACACCATGAACCAGTTTGTGAACAAGTTCAATGTCCTCTACGACCGACAAGGCATCGGCAGGAGAATGCGCGGGCTCTTTTTCTGA
ORF Protein Sequence MAAAAAAAAATNGTGGSSGMEVDAAVVPSVMACGVTGSVSVALHPLVILNISDHWIRMRSQEGRPVQVIGALIGKQEGRNIEVMNSFELLSHTVEEKIIIDKEYYYTKEEQFKQVFKELEFLGWYTTGGPPDPSDIHVHKQVCEIIESPLFLKLNPMTKHTDLPVSVFESVIDIINGEATMLFAELTYTLATEEAERIGVDHVARMTATGSGENSTVAEHLIAQHSAIKMLHSRVKLILEYVKASEAGEVPFNHEILREAYALCHCLPVLSTDKFKTDFYDQCNDVGLMAYLGTITKTCNTMNQFVNKFNVLYDRQGIGRRMRGLFF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1586-Ab Anti-CSN6/ COPS6/ MOV34-34KD functional antibody
    Target Antigen GM-Tg-g-SE1586-Ag COPS6 protein
    ORF Viral Vector pGMLP000698 Human COPS6 Lentivirus plasmid
    ORF Viral Vector vGMLP000698 Human COPS6 Lentivirus particle


    Target information

    Target ID GM-SE1586
    Target Name COPS6
    Gene ID 10980, 26893, 710667, 304343, 101088133, 119872152, 512756, 100068657
    Gene Symbol and Synonyms COPS6,CSN6,MOV34-34KD,Sgn3,VIP/MOV34
    Uniprot Accession Q7L5N1
    Uniprot Entry Name CSN6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000168090
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.