Human M6PR/CD-M6PR/CD-MPR ORF/cDNA clone-Lentivirus particle (NM_002355)
Cat. No.: vGMLP000738
Pre-made Human M6PR/CD-M6PR/CD-MPR Lentiviral expression plasmid for M6PR lentivirus packaging, M6PR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
M6PR/CD-M6PR products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000738 | Human M6PR Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000738 |
| Gene Name | M6PR |
| Accession Number | NM_002355 |
| Gene ID | 4074 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 834 bp |
| Gene Alias | CD-M6PR,CD-MPR,MPR 46,MPR-46,MPR46,SMPR |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTTCCCTTTCTACAGCTGCTGGAGGACTGGACTGCTACTACTACTCCTGGCTGTGGCAGTGAGAGAATCCTGGCAGACAGAAGAAAAAACTTGCGACTTGGTAGGAGAAAAGGGTAAAGAGTCAGAGAAAGAGTTGGCTCTAGTGAAGAGGCTGAAACCACTGTTTAATAAAAGCTTTGAGAGCACTGTGGGCCAGGGTTCAGACACATACATCTACATCTTCAGGGTGTGCCGGGAAGCTGGCAACCACACTTCTGGGGCAGGCCTGGTGCAAATCAACAAAAGTAATGGGAAGGAGACAGTGGTAGGGAGACTCAACGAGACTCACATCTTCAACGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAACCACTGTGGCAAGGAGCAGCGTCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGTGGCAAAGTCCAAGATTGTTTCTACCTCTTTGAGATGGATAGCAGCCTGGCCTGTTCACCAGAGATCTCCCACCTCAGTGTGGGTTCCATCTTACTTGTCACGTTTGCATCACTGGTTGCTGTTTATGTTGTTGGGGGGTTCCTATACCAGCGACTGGTAGTGGGAGCCAAAGGAATGGAGCAGTTTCCCCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGCTGTGACTTTGTCTGCCGTTCTAAACCTCGAAATGTGCCTGCAGCATATCGTGGTGTGGGGGATGACCAGCTGGGGGAGGAGTCAGAAGAAAGGGATGACCATTTATTACCAATGTAG |
| ORF Protein Sequence | MFPFYSCWRTGLLLLLLAVAVRESWQTEEKTCDLVGEKGKESEKELALVKRLKPLFNKSFESTVGQGSDTYIYIFRVCREAGNHTSGAGLVQINKSNGKETVVGRLNETHIFNGSNWIMLIYKGGDEYDNHCGKEQRRAVVMISCNRHTLADNFNPVSEERGKVQDCFYLFEMDSSLACSPEISHLSVGSILLVTFASLVAVYVVGGFLYQRLVVGAKGMEQFPHLAFWQDLGNLVADGCDFVCRSKPRNVPAAYRGVGDDQLGEESEERDDHLLPM |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T97174-Ab | Anti-MPRD/ M6PR/ CD-M6PR monoclonal antibody |
| Target Antigen | GM-Tg-g-T97174-Ag | M6PR VLP (virus-like particle) |
| ORF Viral Vector | pGMLP000738 | Human M6PR Lentivirus plasmid |
| ORF Viral Vector | vGMLP000738 | Human M6PR Lentivirus particle |
Target information
| Target ID | GM-T97174 |
| Target Name | M6PR |
| Gene ID | 4074, 17113, 716696, 312689, 101098389, 477700, 281291, 100061559 |
| Gene Symbol and Synonyms | CD-M6PR,CD-MPR,CDMPR,M6PR,MPR 46,MPR-46,MPR46,SMPR |
| Uniprot Accession | P20645 |
| Uniprot Entry Name | MPRD_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000003056 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


